FvH4_2g40400

calcium-binding protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
OG0005032
Physical Location & Seq
Forward (+)
28775332 .. 28775919
588 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g40400.t1

Sequence Viewer

Length: 588 bp
ATGCAGATCATAGCAATTGGTTCAAAGGCTTACAAATGGTTTTTCACTACTAAGAACTTGATGCTTAAGCTAAACCTCTCTTTCCTTGGTTCGAAACCCAAAAACCATAGCCCTTCTTTATCTGCATCCCTTCCTACTGAAAGTAGCAGCAGTGTCGCAAGTGATGAGAAGCTTGCAAAAGTTTTTGATCATTTTGACACCAACAAAGACGGTAAGATCTCAGCCGACGAACTTCAAGCTTACTTCATGTCAATCGGGGAACCTATGTCCATCAACGAGGCTCAAACTGTGATCAAAGAATTGGATAATGATGGTGACAACTTACTGGAGTTTGAAGACTTCGTCAAATTGATGAGGCGAGAGGACATTGATGCCGATGAAAATGACGATCTTAAGAACGCTTTTGAGATGTTTCAAGTTGATAAAGGCTGTGGATGCATTACACCAAAAGGATTACAAAACATGTTCAATCGACTAGGTGATGCCAAATCCTATGATGAGTGTGTATCCATGATCAGGGTCTTTGATCTTGACGGAAATGGAGTACTCGATTTCCATGAATTTCTGAAGATGATGATTTCAACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0005488 GO:0005509 GO:0043167 GO:0043169 GO:0046872
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
EF-hand_1 EF-hand_7 EF-hand_8

Protein Analysis

196

Amino Acids

21.94

Weight (kDa)

4.65

Isoelectric Point (pI)

26.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_7 PF13499 56 - 119 5.6e-16 EF-hand domain pair
EF-hand_1 PF00036 58 - 84 2.7e-07 EF hand domain
EF-hand_6 PF13405 58 - 86 4.8e-08 EF-hand domain
EF-hand_5 PF13202 59 - 83 1.3e-07 EF hand
EF-hand_9 PF14658 61 - 120 1e-05 EF-hand domain
EF-hand_8 PF13833 73 - 120 6.1e-06 EF-hand domain pair
EF-hand_7 PF13499 129 - 192 2.6e-06 EF-hand domain pair
EF-hand_8 PF13833 145 - 192 7.3e-07 EF-hand domain pair
EF-hand_1 PF00036 168 - 194 3.6e-07 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 560
AcuI CTGAAG 1 cut(s) 587
AfaI GTAC 1 cut(s) 546
AfiI CCNNNNNNNGG 1 cut(s) 516
AflII CTTAAG 2 cut(s) 65, 392
AflIII ACRYGT 1 cut(s) 462
AgsI TTSAA 6 cut(s) 24, 236, 335, 416, 469, 582
AluBI AGCT 3 cut(s) 70, 172, 239
AluI AGCT 3 cut(s) 70, 172, 239
ApeKI GCWGC 1 cut(s) 147
ApoI RAATTY 1 cut(s) 560
AsuHPI GGTGA 2 cut(s) 326, 491
AsuII TTCGAA 1 cut(s) 92
BbsI GAAGAC 1 cut(s) 342
BbvI GCAGC 1 cut(s) 159
BccI CCATC 2 cut(s) 278, 305
BcgI CGANNNNNNTGC 2 cut(s) 136, 170
BciVI GTATCC 1 cut(s) 517
BclI TGATCA 3 cut(s) 187, 291, 513
BfaI CTAG 1 cut(s) 476
BfrI CTTAAG 2 cut(s) 65, 392
BfuI GTATCC 1 cut(s) 517
BglII AGATCT 1 cut(s) 216
BisI GCNGC 1 cut(s) 148
BlsI GCNGC 1 cut(s) 149
BmcAI AGTACT 1 cut(s) 546
BmiI GGNNCC 1 cut(s) 261
BmsI GCATC 5 cut(s) 51, 134, 361, 425, 472
BpiI GAAGAC 1 cut(s) 342
BpmI CTGGAG 1 cut(s) 347
Bpu14I TTCGAA 1 cut(s) 92
BsaJI CCNNGG 1 cut(s) 85
Bsc4I CCNNNNNNNGG 1 cut(s) 516
Bse1I ACTGG 1 cut(s) 330
BseDI CCNNGG 1 cut(s) 85
BseGI GGATG 2 cut(s) 125, 440
BseLI CCNNNNNNNGG 1 cut(s) 516
BseMII CTCAG 1 cut(s) 234
BseNI ACTGG 1 cut(s) 330
BseXI GCAGC 1 cut(s) 159
BslI CCNNNNNNNGG 1 cut(s) 516
Bsp119I TTCGAA 1 cut(s) 92
Bsp143I GATC 7 cut(s) 6, 187, 216, 291, 388, 513, 526
BspCNI CTCAG 1 cut(s) 233
BspLI GGNNCC 1 cut(s) 261
BspT104I TTCGAA 1 cut(s) 92
BspTI CTTAAG 2 cut(s) 65, 392
BsrI ACTGG 1 cut(s) 330
BssECI CCNNGG 1 cut(s) 85
BssMI GATC 7 cut(s) 6, 187, 216, 291, 388, 513, 526
BssT1I CCWWGG 1 cut(s) 85
Bst4CI ACNGT 2 cut(s) 212, 289
BstAFI CTTAAG 2 cut(s) 65, 392
BstBI TTCGAA 1 cut(s) 92
BstC8I GCNNGC 1 cut(s) 174
BstDEI CTNAG 2 cut(s) 51, 220
BstF5I GGATG 2 cut(s) 125, 440
BstKTI GATC 7 cut(s) 9, 190, 219, 294, 391, 516, 529
BstMBI GATC 7 cut(s) 6, 187, 216, 291, 388, 513, 526
BstMWI GCNNNNNNNGC 1 cut(s) 435
BstNSI RCATGY 1 cut(s) 466
BstV1I GCAGC 1 cut(s) 159
BstV2I GAAGAC 1 cut(s) 342
BstX2I RGATCY 1 cut(s) 216
BstYI RGATCY 1 cut(s) 216
BsuI GTATCC 1 cut(s) 517
BtsCI GGATG 2 cut(s) 125, 440
BtsI GCAGTG 1 cut(s) 157
BtsIMutI CAGTG 1 cut(s) 157
Cac8I GCNNGC 1 cut(s) 174
Csp6I GTAC 1 cut(s) 545
CviAII CATG 4 cut(s) 247, 463, 511, 557
CviJI RGCY 8 cut(s) 29, 70, 111, 172, 224, 239, 281, 429
CviKI_1 RGCY 8 cut(s) 29, 70, 111, 172, 224, 239, 281, 429
CviQI GTAC 1 cut(s) 545
DdeI CTNAG 2 cut(s) 51, 220
DpnI GATC 7 cut(s) 8, 189, 218, 293, 390, 515, 528
DpnII GATC 7 cut(s) 6, 187, 216, 291, 388, 513, 526
Eco130I CCWWGG 1 cut(s) 85
Eco57I CTGAAG 1 cut(s) 587
EcoT14I CCWWGG 1 cut(s) 85
EcoT22I ATGCAT 1 cut(s) 440
ErhI CCWWGG 1 cut(s) 85
FaeI CATG 4 cut(s) 250, 466, 514, 560
FaiI YATR 9 cut(s) 11, 108, 248, 266, 464, 495, 512, 558, 586
FatI CATG 4 cut(s) 246, 462, 510, 556
FbaI TGATCA 3 cut(s) 187, 291, 513
Fnu4HI GCNGC 1 cut(s) 148
FokI GGATG 2 cut(s) 112, 447
Fsp4HI GCNGC 1 cut(s) 148
FspBI CTAG 1 cut(s) 476
GluI GCNGC 1 cut(s) 148
GsuI CTGGAG 1 cut(s) 347
Hin1II CATG 4 cut(s) 250, 466, 514, 560
HindIII AAGCTT 2 cut(s) 170, 237
HphI GGTGA 2 cut(s) 326, 491
Hpy188I TCNGA 1 cut(s) 567
Hpy188III TCNNGA 1 cut(s) 530
Hpy99I CGWCG 1 cut(s) 230
HpyAV CCTTC 2 cut(s) 123, 140
HpyCH4III ACNGT 2 cut(s) 212, 289
HpyCH4V TGCA 4 cut(s) 4, 125, 176, 438
HpyF10VI GCNNNNNNNGC 1 cut(s) 435
HpyF3I CTNAG 2 cut(s) 51, 220
Hsp92II CATG 4 cut(s) 250, 466, 514, 560
Ksp22I TGATCA 3 cut(s) 187, 291, 513
Kzo9I GATC 7 cut(s) 6, 187, 216, 291, 388, 513, 526
LpnPI CCDG 2 cut(s) 311, 502
Lsp1109I GCAGC 1 cut(s) 159
LweI GCATC 5 cut(s) 51, 134, 361, 425, 472
MaeI CTAG 1 cut(s) 476
MaeIII GTNAC 1 cut(s) 314
MalI GATC 7 cut(s) 8, 189, 218, 293, 390, 515, 528
MboI GATC 7 cut(s) 6, 187, 216, 291, 388, 513, 526
MboII GAAGA 2 cut(s) 347, 580
MfeI CAATTG 1 cut(s) 15
MflI RGATCY 1 cut(s) 216
MluCI AATT 4 cut(s) 15, 299, 347, 560
MnlI CCTC 4 cut(s) 86, 271, 348, 355
Mph1103I ATGCAT 1 cut(s) 440
MseI TTAA 2 cut(s) 66, 393
MspCI CTTAAG 2 cut(s) 65, 392
MunI CAATTG 1 cut(s) 15
MwoI GCNNNNNNNGC 1 cut(s) 435
NdeII GATC 7 cut(s) 6, 187, 216, 291, 388, 513, 526
NlaIII CATG 4 cut(s) 250, 466, 514, 560
NlaIV GGNNCC 1 cut(s) 261
NmuCI GTSAC 1 cut(s) 314
NsiI ATGCAT 1 cut(s) 440
NspI RCATGY 1 cut(s) 466
NspV TTCGAA 1 cut(s) 92
PciI ACATGT 1 cut(s) 462
PflFI GACNNNGTC 1 cut(s) 341
PkrI GCNGC 1 cut(s) 149
PscI ACATGT 1 cut(s) 462
PspN4I GGNNCC 1 cut(s) 261
PsuI RGATCY 1 cut(s) 216
PsyI GACNNNGTC 1 cut(s) 341
RsaI GTAC 1 cut(s) 546
RsaNI GTAC 1 cut(s) 545
SaqAI TTAA 2 cut(s) 66, 393
SatI GCNGC 1 cut(s) 148
Sau3AI GATC 7 cut(s) 6, 187, 216, 291, 388, 513, 526
ScaI AGTACT 1 cut(s) 546
SetI ASST 6 cut(s) 72, 78, 174, 241, 265, 481
SfaNI GCATC 5 cut(s) 51, 134, 361, 425, 472
SfuI TTCGAA 1 cut(s) 92
SmlI CTYRAG 2 cut(s) 65, 392
SmoI CTYRAG 2 cut(s) 65, 392
Sse9I AATT 4 cut(s) 15, 299, 347, 560
SspMI CTAG 1 cut(s) 476
StyI CCWWGG 1 cut(s) 85
TaaI ACNGT 2 cut(s) 212, 289
TaqI TCGA 3 cut(s) 92, 472, 549
TasI AATT 4 cut(s) 15, 299, 347, 560
TatI WGTACW 1 cut(s) 544
Tru1I TTAA 2 cut(s) 66, 393
Tru9I TTAA 2 cut(s) 66, 393
TscAI CASTG 1 cut(s) 157
TseFI GTSAC 1 cut(s) 314
TseI GCWGC 1 cut(s) 147
Tsp45I GTSAC 1 cut(s) 314
TspDTI ATGAA 3 cut(s) 235, 393, 573
TspGWI ACGGA 1 cut(s) 549
TspRI CASTG 1 cut(s) 157
Tth111I GACNNNGTC 1 cut(s) 341
Vha464I CTTAAG 2 cut(s) 65, 392
XapI RAATTY 1 cut(s) 560
XceI RCATGY 1 cut(s) 466
XspI CTAG 1 cut(s) 476
ZrmI AGTACT 1 cut(s) 546
Zsp2I ATGCAT 1 cut(s) 440
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.