Rw6G035680

calcium-binding protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
OG0005032
Physical Location & Seq
Reverse (-)
60279253 .. 60279837
585 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G035680.1

Sequence Viewer

Length: 585 bp
ATGAAGATCAAGGAAAATGGCTCAAAGCCCTACAAATGGTTTTTCACTGCTAAGAATATGTTTAAGCTAAACCTCTCTTTCCTTGGTTCAAAACCCAAAAGCCATAGCCCCCCTTTATCTTCATCTCTTCCTACTCAAAGTTGTAACAGTGTCGCAAGAAATGAGGAGCTTGCAAAAGTTTTTGATCATTTTGACACCAACAAAGACGGTAAGATCTCAGGCGACGAACTTCAAGCTTACTTCATGTCATTTGGGGAACCCATGTCCACTCATGAGGCTCAAAGTGTGATAAAAGAATTGGACAATGATGGTGATAACTTGTTGGAGTTTGATGACTTCGTCAAATTGATGAGGCGAGAGGATATTGATGCCAATGAAAATGACGATCTAAAGAACGCTTTTGAGATGTTTGAAGTTGATAAAGGTTGCGGATGCATAACACCAAAAGGATTGCAAAGCATGTTCAATCGACTAGGAGATGCCAAATCCTATGATGAGTGTGTATCCATGGTCGGTGTCTTTGATCTTGACGGAAATGGAGTCCTCGATTTCAATGAGTTTCTGAAGATAATGATTTCAACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0005488 GO:0005509 GO:0043167 GO:0043169 GO:0046872
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
EF-hand_1 EF-hand_7 EF-hand_8

Protein Analysis

194

Amino Acids

21.86

Weight (kDa)

4.73

Isoelectric Point (pI)

31.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_7 PF13499 55 - 118 1.3e-15 EF-hand domain pair
EF-hand_6 PF13405 56 - 85 1.2e-07 EF-hand domain
EF-hand_1 PF00036 56 - 83 3.7e-07 EF hand domain
EF-hand_5 PF13202 58 - 82 9.4e-07 EF hand
EF-hand_9 PF14658 60 - 119 1.5e-06 EF-hand domain
EF-hand_7 PF13499 128 - 191 1.8e-06 EF-hand domain pair
EF-hand_8 PF13833 144 - 189 5.6e-06 EF-hand domain pair
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 429
AcuI CTGAAG 1 cut(s) 584
AfiI CCNNNNNNNGG 1 cut(s) 36
AgsI TTSAA 6 cut(s) 90, 233, 413, 466, 553, 579
AluBI AGCT 3 cut(s) 67, 169, 236
AluI AGCT 3 cut(s) 67, 169, 236
AsuHPI GGTGA 1 cut(s) 323
BccI CCATC 1 cut(s) 302
BciVI GTATCC 1 cut(s) 514
BclI TGATCA 1 cut(s) 184
BfaI CTAG 1 cut(s) 473
BfuI GTATCC 1 cut(s) 514
BglII AGATCT 1 cut(s) 213
BmiI GGNNCC 1 cut(s) 258
BmsI GCATC 3 cut(s) 358, 422, 469
BsaJI CCNNGG 2 cut(s) 82, 507
Bsc4I CCNNNNNNNGG 1 cut(s) 36
BseDI CCNNGG 2 cut(s) 82, 507
BseGI GGATG 1 cut(s) 437
BseLI CCNNNNNNNGG 1 cut(s) 36
BseMII CTCAG 1 cut(s) 231
BseRI GAGGAG 1 cut(s) 179
BslI CCNNNNNNNGG 1 cut(s) 36
Bsp143I GATC 5 cut(s) 6, 184, 213, 385, 523
Bsp19I CCATGG 1 cut(s) 507
BspACI CCGC 1 cut(s) 429
BspCNI CTCAG 1 cut(s) 230
BspHI TCATGA 1 cut(s) 271
BspLI GGNNCC 1 cut(s) 258
BssECI CCNNGG 2 cut(s) 82, 507
BssMI GATC 5 cut(s) 6, 184, 213, 385, 523
BssT1I CCWWGG 2 cut(s) 82, 507
Bst4CI ACNGT 2 cut(s) 149, 209
Bst6I CTCTTC 1 cut(s) 132
BstC8I GCNNGC 1 cut(s) 171
BstDEI CTNAG 2 cut(s) 51, 217
BstDSI CCRYGG 1 cut(s) 507
BstF5I GGATG 1 cut(s) 437
BstKTI GATC 5 cut(s) 9, 187, 216, 388, 526
BstMBI GATC 5 cut(s) 6, 184, 213, 385, 523
BstNSI RCATGY 1 cut(s) 463
BstX2I RGATCY 1 cut(s) 213
BstYI RGATCY 1 cut(s) 213
BsuI GTATCC 1 cut(s) 514
BtgI CCRYGG 1 cut(s) 507
BtsCI GGATG 1 cut(s) 437
BtsI GCAGTG 1 cut(s) 45
BtsIMutI CAGTG 2 cut(s) 45, 154
Cac8I GCNNGC 1 cut(s) 171
CciI TCATGA 1 cut(s) 271
CviAII CATG 6 cut(s) 244, 262, 272, 460, 508, 582
CviJI RGCY 8 cut(s) 21, 28, 67, 102, 108, 169, 236, 278
CviKI_1 RGCY 8 cut(s) 21, 28, 67, 102, 108, 169, 236, 278
DdeI CTNAG 2 cut(s) 51, 217
DpnI GATC 5 cut(s) 8, 186, 215, 387, 525
DpnII GATC 5 cut(s) 6, 184, 213, 385, 523
Eam1104I CTCTTC 1 cut(s) 132
EarI CTCTTC 1 cut(s) 132
Eco130I CCWWGG 2 cut(s) 82, 507
Eco57I CTGAAG 1 cut(s) 584
EcoT14I CCWWGG 2 cut(s) 82, 507
EcoT22I ATGCAT 1 cut(s) 437
ErhI CCWWGG 2 cut(s) 82, 507
FaeI CATG 6 cut(s) 247, 265, 275, 463, 511, 585
FatI CATG 6 cut(s) 243, 261, 271, 459, 507, 581
FbaI TGATCA 1 cut(s) 184
FokI GGATG 1 cut(s) 444
FspBI CTAG 1 cut(s) 473
Hin1II CATG 6 cut(s) 247, 265, 275, 463, 511, 585
HindIII AAGCTT 1 cut(s) 234
HinfI GANTC 1 cut(s) 540
HphI GGTGA 1 cut(s) 323
Hpy166II GTNNAC 1 cut(s) 267
Hpy188I TCNGA 1 cut(s) 564
Hpy188III TCNNGA 2 cut(s) 272, 527
Hpy8I GTNNAC 1 cut(s) 267
Hpy99I CGWCG 1 cut(s) 227
HpyCH4III ACNGT 2 cut(s) 149, 209
HpyCH4V TGCA 3 cut(s) 173, 435, 454
HpyF3I CTNAG 2 cut(s) 51, 217
Hsp92II CATG 6 cut(s) 247, 265, 275, 463, 511, 585
Ksp22I TGATCA 1 cut(s) 184
Kzo9I GATC 5 cut(s) 6, 184, 213, 385, 523
LmnI GCTCC 1 cut(s) 166
LpnPI CCDG 1 cut(s) 204
LweI GCATC 3 cut(s) 358, 422, 469
MaeI CTAG 1 cut(s) 473
MaeIII GTNAC 1 cut(s) 143
MalI GATC 5 cut(s) 8, 186, 215, 387, 525
MboI GATC 5 cut(s) 6, 184, 213, 385, 523
MboII GAAGA 4 cut(s) 16, 111, 119, 577
MflI RGATCY 1 cut(s) 213
MluCI AATT 2 cut(s) 296, 344
MlyI GAGTC 1 cut(s) 549
MmeI TCCRAC 1 cut(s) 303
MnlI CCTC 6 cut(s) 83, 157, 268, 345, 352, 554
Mph1103I ATGCAT 1 cut(s) 437
MseI TTAA 1 cut(s) 63
NcoI CCATGG 1 cut(s) 507
NdeII GATC 5 cut(s) 6, 184, 213, 385, 523
NlaIII CATG 6 cut(s) 247, 265, 275, 463, 511, 585
NlaIV GGNNCC 1 cut(s) 258
NsiI ATGCAT 1 cut(s) 437
NspI RCATGY 1 cut(s) 463
PagI TCATGA 1 cut(s) 271
PflFI GACNNNGTC 1 cut(s) 338
PleI GAGTC 1 cut(s) 548
PpsI GAGTC 1 cut(s) 548
PspN4I GGNNCC 1 cut(s) 258
PsuI RGATCY 1 cut(s) 213
PsyI GACNNNGTC 1 cut(s) 338
SaqAI TTAA 1 cut(s) 63
Sau3AI GATC 5 cut(s) 6, 184, 213, 385, 523
SchI GAGTC 1 cut(s) 549
SetI ASST 5 cut(s) 69, 75, 171, 238, 427
SfaNI GCATC 3 cut(s) 358, 422, 469
Sse9I AATT 2 cut(s) 296, 344
SsiI CCGC 1 cut(s) 429
SspMI CTAG 1 cut(s) 473
StyI CCWWGG 2 cut(s) 82, 507
TaaI ACNGT 2 cut(s) 149, 209
TaqI TCGA 2 cut(s) 469, 546
TasI AATT 2 cut(s) 296, 344
Tru1I TTAA 1 cut(s) 63
Tru9I TTAA 1 cut(s) 63
TscAI CASTG 2 cut(s) 52, 154
TspDTI ATGAA 4 cut(s) 17, 111, 232, 390
TspGWI ACGGA 1 cut(s) 546
TspRI CASTG 2 cut(s) 52, 154
Tth111I GACNNNGTC 1 cut(s) 338
XceI RCATGY 1 cut(s) 463
XspI CTAG 1 cut(s) 473
Zsp2I ATGCAT 1 cut(s) 437
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.