Rroxscaffold_7G00167870

calcium-binding protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0005032
Physical Location & Seq
Forward (+)
8871368 .. 8871895
528 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00167870.1

Sequence Viewer

Length: 528 bp
ATGTTTAAGCTAAACCTCTCTTTCCTTGGTTCAAAACCCAAAAGCCATAGCCCTTCTTTATCTTCATCTCTTCCTACTCAAAGTTGCAACAGTGTCGCAAGAAATGAGGAGCTTGCAAAAGTTTTTGATCATTTTGACACCAACAAAGACGGGAAGATCTCAGGCGACGAACTTCAAGCTTACTTTATATCAATTGGGGAACCCATGTCCACTCATGAGGCTCAAAGTGTGATAAAAGAATTGGACAATGACGGTGATAACTTGTTGGAGTTTGATGACTTCGTCAAATTGATGAGGCGAGAGGATATTGATGCCAATGAAAATGACGATCTGAAGAACGCTTTTGAGATGTTTGAAGTTGATAAAGGTTGCGGATGCATAACACCAAAAGGATTGCAAAACATGTTCAATCGACTAGGAGATGCCAGATCATATAATGAGTGTGTATCCATGATCGGTGTCTTTGATCTTGACGGAAATGGAGTCCTCGATTTCAATGAATTTCTGAAGATGATGATTTCAACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0005488 GO:0005509 GO:0043167 GO:0043169 GO:0046872
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
EF-hand_1 EF-hand_7 EF-hand_8

Protein Analysis

175

Amino Acids

19.59

Weight (kDa)

4.49

Isoelectric Point (pI)

34.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_7 PF13499 36 - 99 1.3e-16 EF-hand domain pair
EF-hand_1 PF00036 37 - 63 6.6e-07 EF hand domain
EF-hand_6 PF13405 37 - 66 2.6e-07 EF-hand domain
EF-hand_5 PF13202 39 - 62 1.7e-06 EF hand
EF-hand_9 PF14658 41 - 100 1.3e-06 EF-hand domain
EF-hand_7 PF13499 109 - 172 1.2e-06 EF-hand domain pair
EF-hand_8 PF13833 125 - 172 6e-06 EF-hand domain pair
EF-hand_1 PF00036 148 - 174 3e-06 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 372
AcsI RAATTY 1 cut(s) 500
AcuI CTGAAG 2 cut(s) 353, 527
AflIII ACRYGT 1 cut(s) 402
AgsI TTSAA 6 cut(s) 33, 176, 356, 409, 496, 522
AluBI AGCT 3 cut(s) 10, 112, 179
AluI AGCT 3 cut(s) 10, 112, 179
ApoI RAATTY 1 cut(s) 500
AsuHPI GGTGA 1 cut(s) 266
BcgI CGANNNNNNTGC 2 cut(s) 76, 110
BciVI GTATCC 1 cut(s) 457
BclI TGATCA 1 cut(s) 127
BfaI CTAG 1 cut(s) 416
BfuI GTATCC 1 cut(s) 457
BglII AGATCT 1 cut(s) 156
BmiI GGNNCC 1 cut(s) 201
BmsI GCATC 3 cut(s) 301, 365, 412
BsaJI CCNNGG 1 cut(s) 25
BseDI CCNNGG 1 cut(s) 25
BseGI GGATG 1 cut(s) 380
BseMII CTCAG 1 cut(s) 174
BseRI GAGGAG 1 cut(s) 122
Bsp143I GATC 6 cut(s) 127, 156, 328, 428, 453, 466
BspACI CCGC 1 cut(s) 372
BspCNI CTCAG 1 cut(s) 173
BspHI TCATGA 1 cut(s) 214
BspLI GGNNCC 1 cut(s) 201
BssECI CCNNGG 1 cut(s) 25
BssMI GATC 6 cut(s) 127, 156, 328, 428, 453, 466
BssT1I CCWWGG 1 cut(s) 25
Bst4CI ACNGT 2 cut(s) 92, 254
Bst6I CTCTTC 1 cut(s) 75
BstC8I GCNNGC 1 cut(s) 114
BstDEI CTNAG 1 cut(s) 160
BstF5I GGATG 1 cut(s) 380
BstKTI GATC 6 cut(s) 130, 159, 331, 431, 456, 469
BstMBI GATC 6 cut(s) 127, 156, 328, 428, 453, 466
BstNSI RCATGY 1 cut(s) 406
BstX2I RGATCY 1 cut(s) 156
BstYI RGATCY 1 cut(s) 156
BsuI GTATCC 1 cut(s) 457
BtsCI GGATG 1 cut(s) 380
BtsIMutI CAGTG 1 cut(s) 97
Cac8I GCNNGC 1 cut(s) 114
CciI TCATGA 1 cut(s) 214
CviAII CATG 5 cut(s) 205, 215, 403, 451, 525
CviJI RGCY 6 cut(s) 10, 45, 51, 112, 179, 221
CviKI_1 RGCY 6 cut(s) 10, 45, 51, 112, 179, 221
DdeI CTNAG 1 cut(s) 160
DpnI GATC 6 cut(s) 129, 158, 330, 430, 455, 468
DpnII GATC 6 cut(s) 127, 156, 328, 428, 453, 466
Eam1104I CTCTTC 1 cut(s) 75
EarI CTCTTC 1 cut(s) 75
Eco130I CCWWGG 1 cut(s) 25
Eco57I CTGAAG 2 cut(s) 353, 527
EcoT14I CCWWGG 1 cut(s) 25
EcoT22I ATGCAT 1 cut(s) 380
ErhI CCWWGG 1 cut(s) 25
FaeI CATG 5 cut(s) 208, 218, 406, 454, 528
FatI CATG 5 cut(s) 204, 214, 402, 450, 524
FbaI TGATCA 1 cut(s) 127
FokI GGATG 1 cut(s) 387
FspBI CTAG 1 cut(s) 416
Hin1II CATG 5 cut(s) 208, 218, 406, 454, 528
HindIII AAGCTT 1 cut(s) 177
HinfI GANTC 1 cut(s) 483
HphI GGTGA 1 cut(s) 266
Hpy166II GTNNAC 1 cut(s) 210
Hpy188I TCNGA 2 cut(s) 333, 507
Hpy188III TCNNGA 2 cut(s) 215, 470
Hpy8I GTNNAC 1 cut(s) 210
Hpy99I CGWCG 1 cut(s) 170
HpyAV CCTTC 1 cut(s) 63
HpyCH4III ACNGT 2 cut(s) 92, 254
HpyCH4V TGCA 4 cut(s) 87, 116, 378, 397
HpyF3I CTNAG 1 cut(s) 160
Hsp92II CATG 5 cut(s) 208, 218, 406, 454, 528
Ksp22I TGATCA 1 cut(s) 127
Kzo9I GATC 6 cut(s) 127, 156, 328, 428, 453, 466
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 2 cut(s) 147, 439
LweI GCATC 3 cut(s) 301, 365, 412
MaeI CTAG 1 cut(s) 416
MalI GATC 6 cut(s) 129, 158, 330, 430, 455, 468
MboI GATC 6 cut(s) 127, 156, 328, 428, 453, 466
MboII GAAGA 5 cut(s) 54, 62, 166, 346, 520
MfeI CAATTG 1 cut(s) 192
MflI RGATCY 1 cut(s) 156
MluCI AATT 4 cut(s) 192, 239, 287, 500
MlyI GAGTC 1 cut(s) 492
MmeI TCCRAC 1 cut(s) 246
MnlI CCTC 6 cut(s) 26, 100, 211, 288, 295, 497
Mph1103I ATGCAT 1 cut(s) 380
MseI TTAA 1 cut(s) 6
MunI CAATTG 1 cut(s) 192
NdeII GATC 6 cut(s) 127, 156, 328, 428, 453, 466
NlaIII CATG 5 cut(s) 208, 218, 406, 454, 528
NlaIV GGNNCC 1 cut(s) 201
NsiI ATGCAT 1 cut(s) 380
NspI RCATGY 1 cut(s) 406
PagI TCATGA 1 cut(s) 214
PciI ACATGT 1 cut(s) 402
PflFI GACNNNGTC 1 cut(s) 281
PleI GAGTC 1 cut(s) 491
PpsI GAGTC 1 cut(s) 491
PscI ACATGT 1 cut(s) 402
PspN4I GGNNCC 1 cut(s) 201
PsuI RGATCY 1 cut(s) 156
PsyI GACNNNGTC 1 cut(s) 281
SaqAI TTAA 1 cut(s) 6
Sau3AI GATC 6 cut(s) 127, 156, 328, 428, 453, 466
SchI GAGTC 1 cut(s) 492
SetI ASST 5 cut(s) 12, 18, 114, 181, 370
SfaNI GCATC 3 cut(s) 301, 365, 412
Sse9I AATT 4 cut(s) 192, 239, 287, 500
SsiI CCGC 1 cut(s) 372
SspMI CTAG 1 cut(s) 416
StyI CCWWGG 1 cut(s) 25
TaaI ACNGT 2 cut(s) 92, 254
TaqI TCGA 2 cut(s) 412, 489
TasI AATT 4 cut(s) 192, 239, 287, 500
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TscAI CASTG 1 cut(s) 97
TspDTI ATGAA 3 cut(s) 54, 333, 513
TspGWI ACGGA 1 cut(s) 489
TspRI CASTG 1 cut(s) 97
Tth111I GACNNNGTC 1 cut(s) 281
XapI RAATTY 1 cut(s) 500
XceI RCATGY 1 cut(s) 406
XspI CTAG 1 cut(s) 416
Zsp2I ATGCAT 1 cut(s) 380
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.