Rh6CG422700

calcium-binding protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0005032
Physical Location & Seq
Reverse (-)
60560196 .. 60560747
552 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG422700.1

Sequence Viewer

Length: 552 bp
ATGGCTCAAAGCCCTACAAATGGTTTTTCACTGCTAAACCTCTCTTTCCTTGGTTCAAAACCCAAAAGCCATAGCCCCCCTTTATCTTCATCTCTTCCTACTCAAAGTTGTAACAGTGTCGCAAGAAATGAGGAGCTTGCAAAAGTTTTTGATCATTTTGACACCAACAAAGACGGTAAGATCTCAGGCGACGAACTTCAAGCTTACTTCATGTCAATTGGGGAACCCATGTCCACTCATGAGGCTCGAAGTGTGATAAAAGAATTGGACAATGATGGAGATAACTTGTTGGAGTTTGATGACTTCGTCAAATTGATGAGGCGAGAGGATATTGATGCCAATGAAAATGACGATCTAAAGAACGCTTTTGAGATGTTTGAAGTTGATAAAGGTTGCGGATGCATAACACCAAAAGGATTGCAAAGCATGTTCAATCGACTAGGAGATGCCAAATCCTATGATGAGTGTGTATCCATGGTCGGTGTCTTTGATCTTGACGGAAATGGAGTCCTCGATTTCAATGAATTTCTGAAGATAATGATTTCAACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0005488 GO:0005509 GO:0043167 GO:0043169 GO:0046872
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
EF-hand_1 EF-hand_7 EF-hand_8

Protein Analysis

183

Amino Acids

20.28

Weight (kDa)

4.45

Isoelectric Point (pI)

39.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_7 PF13499 44 - 107 3.2e-16 EF-hand domain pair
EF-hand_6 PF13405 45 - 74 1.3e-07 EF-hand domain
EF-hand_1 PF00036 45 - 72 3.3e-07 EF hand domain
EF-hand_5 PF13202 47 - 71 8.6e-07 EF hand
EF-hand_9 PF14658 49 - 108 6.4e-06 EF-hand domain
EF-hand_7 PF13499 117 - 180 1.6e-06 EF-hand domain pair
EF-hand_8 PF13833 133 - 178 5.1e-06 EF-hand domain pair
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 396
AcsI RAATTY 1 cut(s) 524
AcuI CTGAAG 1 cut(s) 551
AfiI CCNNNNNNNGG 1 cut(s) 20
AgsI TTSAA 6 cut(s) 57, 200, 380, 433, 520, 546
AluBI AGCT 2 cut(s) 136, 203
AluI AGCT 2 cut(s) 136, 203
ApoI RAATTY 1 cut(s) 524
BccI CCATC 1 cut(s) 269
BciVI GTATCC 1 cut(s) 481
BclI TGATCA 1 cut(s) 151
BfaI CTAG 1 cut(s) 440
BfuI GTATCC 1 cut(s) 481
BglII AGATCT 1 cut(s) 180
BmiI GGNNCC 1 cut(s) 225
BmsI GCATC 3 cut(s) 325, 389, 436
BsaJI CCNNGG 2 cut(s) 49, 474
Bsc4I CCNNNNNNNGG 1 cut(s) 20
BseDI CCNNGG 2 cut(s) 49, 474
BseGI GGATG 1 cut(s) 404
BseLI CCNNNNNNNGG 1 cut(s) 20
BseMII CTCAG 1 cut(s) 198
BseRI GAGGAG 1 cut(s) 146
BslI CCNNNNNNNGG 1 cut(s) 20
Bsp143I GATC 4 cut(s) 151, 180, 352, 490
Bsp19I CCATGG 1 cut(s) 474
BspACI CCGC 1 cut(s) 396
BspCNI CTCAG 1 cut(s) 197
BspHI TCATGA 1 cut(s) 238
BspLI GGNNCC 1 cut(s) 225
BssECI CCNNGG 2 cut(s) 49, 474
BssMI GATC 4 cut(s) 151, 180, 352, 490
BssT1I CCWWGG 2 cut(s) 49, 474
Bst4CI ACNGT 2 cut(s) 116, 176
Bst6I CTCTTC 1 cut(s) 99
BstC8I GCNNGC 1 cut(s) 138
BstDEI CTNAG 1 cut(s) 184
BstDSI CCRYGG 1 cut(s) 474
BstF5I GGATG 1 cut(s) 404
BstKTI GATC 4 cut(s) 154, 183, 355, 493
BstMBI GATC 4 cut(s) 151, 180, 352, 490
BstNSI RCATGY 1 cut(s) 430
BstX2I RGATCY 1 cut(s) 180
BstYI RGATCY 1 cut(s) 180
BsuI GTATCC 1 cut(s) 481
BtgI CCRYGG 1 cut(s) 474
BtsCI GGATG 1 cut(s) 404
BtsI GCAGTG 1 cut(s) 29
BtsIMutI CAGTG 2 cut(s) 29, 121
Cac8I GCNNGC 1 cut(s) 138
CciI TCATGA 1 cut(s) 238
CviAII CATG 6 cut(s) 211, 229, 239, 427, 475, 549
CviJI RGCY 7 cut(s) 5, 12, 69, 75, 136, 203, 245
CviKI_1 RGCY 7 cut(s) 5, 12, 69, 75, 136, 203, 245
DdeI CTNAG 1 cut(s) 184
DpnI GATC 4 cut(s) 153, 182, 354, 492
DpnII GATC 4 cut(s) 151, 180, 352, 490
Eam1104I CTCTTC 1 cut(s) 99
EarI CTCTTC 1 cut(s) 99
Eco130I CCWWGG 2 cut(s) 49, 474
Eco57I CTGAAG 1 cut(s) 551
EcoT14I CCWWGG 2 cut(s) 49, 474
EcoT22I ATGCAT 1 cut(s) 404
ErhI CCWWGG 2 cut(s) 49, 474
FaeI CATG 6 cut(s) 214, 232, 242, 430, 478, 552
FaiI YATR 9 cut(s) 72, 212, 230, 240, 404, 428, 459, 476, 550
FatI CATG 6 cut(s) 210, 228, 238, 426, 474, 548
FbaI TGATCA 1 cut(s) 151
FokI GGATG 1 cut(s) 411
FspBI CTAG 1 cut(s) 440
Hin1II CATG 6 cut(s) 214, 232, 242, 430, 478, 552
HindIII AAGCTT 1 cut(s) 201
HinfI GANTC 1 cut(s) 507
Hpy166II GTNNAC 1 cut(s) 234
Hpy188I TCNGA 1 cut(s) 531
Hpy188III TCNNGA 2 cut(s) 239, 494
Hpy8I GTNNAC 1 cut(s) 234
Hpy99I CGWCG 1 cut(s) 194
HpyCH4III ACNGT 2 cut(s) 116, 176
HpyCH4V TGCA 3 cut(s) 140, 402, 421
HpyF3I CTNAG 1 cut(s) 184
Hsp92II CATG 6 cut(s) 214, 232, 242, 430, 478, 552
Ksp22I TGATCA 1 cut(s) 151
Kzo9I GATC 4 cut(s) 151, 180, 352, 490
LmnI GCTCC 1 cut(s) 133
LpnPI CCDG 1 cut(s) 171
LweI GCATC 3 cut(s) 325, 389, 436
MaeI CTAG 1 cut(s) 440
MaeIII GTNAC 1 cut(s) 110
MalI GATC 4 cut(s) 153, 182, 354, 492
MboI GATC 4 cut(s) 151, 180, 352, 490
MboII GAAGA 3 cut(s) 78, 86, 544
MfeI CAATTG 1 cut(s) 216
MflI RGATCY 1 cut(s) 180
MluCI AATT 4 cut(s) 216, 263, 311, 524
MlyI GAGTC 1 cut(s) 516
MmeI TCCRAC 1 cut(s) 270
MnlI CCTC 6 cut(s) 50, 124, 235, 312, 319, 521
Mph1103I ATGCAT 1 cut(s) 404
MunI CAATTG 1 cut(s) 216
NcoI CCATGG 1 cut(s) 474
NdeII GATC 4 cut(s) 151, 180, 352, 490
NlaIII CATG 6 cut(s) 214, 232, 242, 430, 478, 552
NlaIV GGNNCC 1 cut(s) 225
NsiI ATGCAT 1 cut(s) 404
NspI RCATGY 1 cut(s) 430
PagI TCATGA 1 cut(s) 238
PflFI GACNNNGTC 1 cut(s) 305
PleI GAGTC 1 cut(s) 515
PpsI GAGTC 1 cut(s) 515
PspN4I GGNNCC 1 cut(s) 225
PsuI RGATCY 1 cut(s) 180
PsyI GACNNNGTC 1 cut(s) 305
Sau3AI GATC 4 cut(s) 151, 180, 352, 490
SchI GAGTC 1 cut(s) 516
SetI ASST 4 cut(s) 42, 138, 205, 394
SfaNI GCATC 3 cut(s) 325, 389, 436
Sse9I AATT 4 cut(s) 216, 263, 311, 524
SsiI CCGC 1 cut(s) 396
SspMI CTAG 1 cut(s) 440
StyI CCWWGG 2 cut(s) 49, 474
TaaI ACNGT 2 cut(s) 116, 176
TaqI TCGA 3 cut(s) 247, 436, 513
TasI AATT 4 cut(s) 216, 263, 311, 524
TscAI CASTG 2 cut(s) 36, 121
TspDTI ATGAA 4 cut(s) 78, 199, 357, 537
TspGWI ACGGA 1 cut(s) 513
TspRI CASTG 2 cut(s) 36, 121
Tth111I GACNNNGTC 1 cut(s) 305
XapI RAATTY 1 cut(s) 524
XceI RCATGY 1 cut(s) 430
XspI CTAG 1 cut(s) 440
Zsp2I ATGCAT 1 cut(s) 404
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.