RLG00000011345

calcium-binding protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
OG0005032
Physical Location & Seq
Forward (+)
8770962 .. 8771497
536 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000011345

Sequence Viewer

Length: 414 bp
ATGAAGATCAAGGAAAATGGCTCAAAGCCCTACAAATGGTTTTTCACTGGCGACGAACTTCAAGCTTACTTCATGTCAATTGGGGAACCCATGTCCACTCATGAGGCTCAAAGTGTGATAAAAGAATTGGACAATGACGGTGATAACTTGTTGGAGTTTGATGACTTCGTCAAATTGATGAGGCGAGAGGATATTGATGCCAATGGAAATGACGATCTAAAGGACGCTTTTGAGATGTTTGAAGTTGATAAAGGTTGCGGATGCATAACACCAAAAGGATTGCAAAACATGTTCAATCGACTAGGAGATGCCAAATCCTATGATGAGTGTGTATCCATGATCGGTGTCTTTGATCTTGACGGAAATGGAGTCCTCGATTTCAATGAATTTCTGAAGATGATGATTTCAACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0005488 GO:0005509 GO:0043167 GO:0043169 GO:0046872
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
EF-hand_1 EF-hand_7 EF-hand_8

Protein Analysis

138

Amino Acids

15.58

Weight (kDa)

4.28

Isoelectric Point (pI)

24.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_7 PF13499 16 - 61 3.6e-08 EF-hand domain pair
EF-hand_8 PF13833 19 - 62 5e-06 EF-hand domain pair
EF-hand_7 PF13499 71 - 134 2e-07 EF-hand domain pair
EF-hand_8 PF13833 87 - 134 2.5e-06 EF-hand domain pair
EF-hand_1 PF00036 110 - 136 2e-06 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 258
AcsI RAATTY 1 cut(s) 386
AcuI CTGAAG 1 cut(s) 413
AfiI CCNNNNNNNGG 1 cut(s) 36
AflIII ACRYGT 1 cut(s) 288
AgsI TTSAA 5 cut(s) 62, 242, 295, 382, 408
AluBI AGCT 1 cut(s) 65
AluI AGCT 1 cut(s) 65
ApoI RAATTY 1 cut(s) 386
AsuHPI GGTGA 1 cut(s) 152
BciVI GTATCC 1 cut(s) 343
BfaI CTAG 1 cut(s) 302
BfuI GTATCC 1 cut(s) 343
BmiI GGNNCC 1 cut(s) 87
BmsI GCATC 3 cut(s) 187, 251, 298
Bsc4I CCNNNNNNNGG 1 cut(s) 36
Bse1I ACTGG 1 cut(s) 52
BseGI GGATG 1 cut(s) 266
BseLI CCNNNNNNNGG 1 cut(s) 36
BseNI ACTGG 1 cut(s) 52
BslI CCNNNNNNNGG 1 cut(s) 36
Bsp143I GATC 4 cut(s) 6, 214, 339, 352
BspACI CCGC 1 cut(s) 258
BspHI TCATGA 1 cut(s) 100
BspLI GGNNCC 1 cut(s) 87
BsrI ACTGG 1 cut(s) 52
BssMI GATC 4 cut(s) 6, 214, 339, 352
Bst4CI ACNGT 1 cut(s) 140
BstF5I GGATG 1 cut(s) 266
BstKTI GATC 4 cut(s) 9, 217, 342, 355
BstMBI GATC 4 cut(s) 6, 214, 339, 352
BstNSI RCATGY 1 cut(s) 292
BsuI GTATCC 1 cut(s) 343
BtsCI GGATG 1 cut(s) 266
BtsIMutI CAGTG 1 cut(s) 45
CciI TCATGA 1 cut(s) 100
CseI GACGC 1 cut(s) 233
CviAII CATG 6 cut(s) 73, 91, 101, 289, 337, 411
CviJI RGCY 4 cut(s) 21, 28, 65, 107
CviKI_1 RGCY 4 cut(s) 21, 28, 65, 107
DpnI GATC 4 cut(s) 8, 216, 341, 354
DpnII GATC 4 cut(s) 6, 214, 339, 352
Eco57I CTGAAG 1 cut(s) 413
EcoT22I ATGCAT 1 cut(s) 266
FaeI CATG 6 cut(s) 76, 94, 104, 292, 340, 414
FaiI YATR 8 cut(s) 74, 92, 102, 266, 290, 321, 338, 412
FatI CATG 6 cut(s) 72, 90, 100, 288, 336, 410
FokI GGATG 1 cut(s) 273
FspBI CTAG 1 cut(s) 302
HgaI GACGC 1 cut(s) 233
Hin1II CATG 6 cut(s) 76, 94, 104, 292, 340, 414
HindIII AAGCTT 1 cut(s) 63
HinfI GANTC 1 cut(s) 369
HphI GGTGA 1 cut(s) 152
Hpy166II GTNNAC 1 cut(s) 96
Hpy188I TCNGA 1 cut(s) 393
Hpy188III TCNNGA 2 cut(s) 101, 356
Hpy8I GTNNAC 1 cut(s) 96
Hpy99I CGWCG 1 cut(s) 56
HpyCH4III ACNGT 1 cut(s) 140
HpyCH4V TGCA 2 cut(s) 264, 283
Hsp92II CATG 6 cut(s) 76, 94, 104, 292, 340, 414
Kzo9I GATC 4 cut(s) 6, 214, 339, 352
LpnPI CCDG 1 cut(s) 33
LweI GCATC 3 cut(s) 187, 251, 298
MaeI CTAG 1 cut(s) 302
MalI GATC 4 cut(s) 8, 216, 341, 354
MboI GATC 4 cut(s) 6, 214, 339, 352
MboII GAAGA 2 cut(s) 16, 406
MfeI CAATTG 1 cut(s) 78
MluCI AATT 4 cut(s) 78, 125, 173, 386
MlyI GAGTC 1 cut(s) 378
MmeI TCCRAC 1 cut(s) 132
MnlI CCTC 4 cut(s) 97, 174, 181, 383
Mph1103I ATGCAT 1 cut(s) 266
MunI CAATTG 1 cut(s) 78
NdeII GATC 4 cut(s) 6, 214, 339, 352
NlaIII CATG 6 cut(s) 76, 94, 104, 292, 340, 414
NlaIV GGNNCC 1 cut(s) 87
NsiI ATGCAT 1 cut(s) 266
NspI RCATGY 1 cut(s) 292
PagI TCATGA 1 cut(s) 100
PciI ACATGT 1 cut(s) 288
PflFI GACNNNGTC 1 cut(s) 167
PleI GAGTC 1 cut(s) 377
PpsI GAGTC 1 cut(s) 377
PscI ACATGT 1 cut(s) 288
PspN4I GGNNCC 1 cut(s) 87
PsyI GACNNNGTC 1 cut(s) 167
Sau3AI GATC 4 cut(s) 6, 214, 339, 352
SchI GAGTC 1 cut(s) 378
SetI ASST 2 cut(s) 67, 256
SfaNI GCATC 3 cut(s) 187, 251, 298
Sse9I AATT 4 cut(s) 78, 125, 173, 386
SsiI CCGC 1 cut(s) 258
SspMI CTAG 1 cut(s) 302
TaaI ACNGT 1 cut(s) 140
TaqI TCGA 2 cut(s) 298, 375
TasI AATT 4 cut(s) 78, 125, 173, 386
TscAI CASTG 1 cut(s) 52
TspDTI ATGAA 3 cut(s) 17, 61, 399
TspGWI ACGGA 1 cut(s) 375
TspRI CASTG 1 cut(s) 52
Tth111I GACNNNGTC 1 cut(s) 167
XapI RAATTY 1 cut(s) 386
XceI RCATGY 1 cut(s) 292
XspI CTAG 1 cut(s) 302
Zsp2I ATGCAT 1 cut(s) 266
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.