FvH4_3g01200

Belongs to the plant LTP family

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Forward (+)
585320 .. 586022
703 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g01200.t1

Sequence Viewer

Length: 486 bp
ATGACAAGCCTATATAAAAAGCACAACATACCTTGGGTTTATTCATCTTACATCAAACCCAATAATATATCTCAAATTACAATTTCATCAACCCATTTGTTCCAATTCCAAAGGTTCTCTAGTATGGAGAAGAAAATGATGGCTTTCTTTGGGTTGGTAATTACAGTCGTCCTCCTCAATGCATGTCCTGCAATCGGAGAGTGCTACGGTGAATTAGTTGAGTTGTTACCTTGTGCGACGTTCATTATGGGCCCTGGCATAGGGCAGCCCCCAGAAATGTGTTGCTCAGGTATGCAACACGTGGTTGCTGAAGCTGATACTATTGAGAAACGCAGGAGTATTTGCCAATGTTTGAAAGACAAAGCTGTTGGTGCTAGCGTTAAAGTCGACCCTGAAAAAATTAAGCACACTACTAAGGCGTGTGGCGTAAAAATTCCTATTCCTATTGATCCTAATGTCGACTGCAACACAATTCCGATGTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

162

Amino Acids

17.81

Weight (kDa)

8.36

Isoelectric Point (pI)

36.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LTP_2 PF14368 60 - 146 3.8e-06 Probable lipid transfer
Tryp_alpha_amyl PF00234 68 - 155 1.3e-09 Protease inhibitor/seed storage/LTP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 387, 459
AclWI GGATC 1 cut(s) 443
AcsI RAATTY 1 cut(s) 432
AcuI CTGAAG 1 cut(s) 330
AcvI CACGTG 1 cut(s) 301
AfiI CCNNNNNNNGG 2 cut(s) 194, 260
AflIII ACRYGT 1 cut(s) 298
AgsI TTSAA 1 cut(s) 355
AjnI CCWGG 1 cut(s) 253
AluBI AGCT 2 cut(s) 314, 365
AluI AGCT 2 cut(s) 314, 365
AlwI GGATC 1 cut(s) 443
AoxI GGCC 1 cut(s) 250
ApaI GGGCCC 1 cut(s) 254
ApeKI GCWGC 1 cut(s) 265
ApoI RAATTY 1 cut(s) 432
AspS9I GGNCC 2 cut(s) 250, 251
AsuHPI GGTGA 1 cut(s) 221
AsuNHI GCTAGC 1 cut(s) 374
BaeGI GKGCMC 1 cut(s) 254
BanII GRGCYC 1 cut(s) 254
BbrPI CACGTG 1 cut(s) 301
BbvI GCAGC 1 cut(s) 277
BccI CCATC 1 cut(s) 133
BciT130I CCWGG 1 cut(s) 255
BfaI CTAG 2 cut(s) 120, 375
BisI GCNGC 1 cut(s) 266
BlsI GCNGC 1 cut(s) 267
Bme1390I CCNGG 1 cut(s) 255
BmgT120I GGNCC 2 cut(s) 250, 251
BmiI GGNNCC 1 cut(s) 252
BmrFI CCNGG 1 cut(s) 255
BmtI GCTAGC 1 cut(s) 378
Bpu10I CCTNAGC 1 cut(s) 286
BsaAI YACGTR 1 cut(s) 301
BsaJI CCNNGG 2 cut(s) 32, 253
Bsc4I CCNNNNNNNGG 2 cut(s) 194, 260
BseBI CCWGG 1 cut(s) 255
BseDI CCNNGG 2 cut(s) 32, 253
BseLI CCNNNNNNNGG 2 cut(s) 194, 260
BseMII CTCAG 1 cut(s) 300
BseRI GAGGAG 1 cut(s) 164
BseSI GKGCMC 1 cut(s) 254
BseXI GCAGC 1 cut(s) 277
BshFI GGCC 1 cut(s) 252
BslI CCNNNNNNNGG 2 cut(s) 194, 260
BsnI GGCC 1 cut(s) 252
Bsp120I GGGCCC 1 cut(s) 250
Bsp1286I GDGCHC 1 cut(s) 254
Bsp143I GATC 1 cut(s) 448
BspANI GGCC 1 cut(s) 252
BspCNI CTCAG 1 cut(s) 299
BspLI GGNNCC 1 cut(s) 252
BspOI GCTAGC 1 cut(s) 378
BspPI GGATC 1 cut(s) 443
BssECI CCNNGG 2 cut(s) 32, 253
BssMI GATC 1 cut(s) 448
BssT1I CCWWGG 1 cut(s) 32
Bst2UI CCWGG 1 cut(s) 255
Bst4CI ACNGT 2 cut(s) 166, 209
BstAPI GCANNNNNTGC 1 cut(s) 188
BstBAI YACGTR 1 cut(s) 301
BstC8I GCNNGC 1 cut(s) 376
BstDEI CTNAG 2 cut(s) 286, 414
BstENI CCTNNNNNAGG 1 cut(s) 258
BstKTI GATC 1 cut(s) 451
BstMBI GATC 1 cut(s) 448
BstMWI GCNNNNNNNGC 2 cut(s) 188, 371
BstNI CCWGG 1 cut(s) 255
BstNSI RCATGY 1 cut(s) 186
BstSCI CCNGG 1 cut(s) 253
BstSLI GKGCMC 1 cut(s) 254
BstV1I GCAGC 1 cut(s) 277
BsuRI GGCC 1 cut(s) 252
Cac8I GCNNGC 1 cut(s) 376
Cfr13I GGNCC 2 cut(s) 250, 251
CviAII CATG 1 cut(s) 183
CviJI RGCY 6 cut(s) 9, 143, 252, 268, 314, 365
CviKI_1 RGCY 6 cut(s) 9, 143, 252, 268, 314, 365
DdeI CTNAG 2 cut(s) 286, 414
DpnI GATC 1 cut(s) 450
DpnII GATC 1 cut(s) 448
Eco130I CCWWGG 1 cut(s) 32
Eco24I GRGCYC 1 cut(s) 254
Eco57I CTGAAG 1 cut(s) 330
Eco72I CACGTG 1 cut(s) 301
EcoNI CCTNNNNNAGG 1 cut(s) 258
EcoO109I RGGNCCY 1 cut(s) 251
EcoRII CCWGG 1 cut(s) 253
EcoT14I CCWWGG 1 cut(s) 32
EcoT22I ATGCAT 1 cut(s) 184
EcoT38I GRGCYC 1 cut(s) 254
ErhI CCWWGG 1 cut(s) 32
FaeI CATG 1 cut(s) 186
FaiI YATR 9 cut(s) 13, 15, 29, 68, 125, 184, 248, 260, 293
FatI CATG 1 cut(s) 182
FblI GTMKAC 2 cut(s) 387, 459
Fnu4HI GCNGC 1 cut(s) 266
FriOI GRGCYC 1 cut(s) 254
Fsp4HI GCNGC 1 cut(s) 266
FspBI CTAG 2 cut(s) 120, 375
GluI GCNGC 1 cut(s) 266
HaeIII GGCC 1 cut(s) 252
Hin1II CATG 1 cut(s) 186
HincII GTYRAC 2 cut(s) 388, 460
HindII GTYRAC 2 cut(s) 388, 460
HphI GGTGA 1 cut(s) 221
Hpy166II GTNNAC 2 cut(s) 388, 460
Hpy188I TCNGA 2 cut(s) 197, 477
Hpy8I GTNNAC 2 cut(s) 388, 460
Hpy99I CGWCG 1 cut(s) 241
HpyCH4III ACNGT 2 cut(s) 166, 209
HpyCH4IV ACGT 2 cut(s) 239, 300
HpyCH4V TGCA 4 cut(s) 182, 191, 295, 465
HpyF10VI GCNNNNNNNGC 2 cut(s) 188, 371
HpyF3I CTNAG 2 cut(s) 286, 414
HpySE526I ACGT 2 cut(s) 239, 300
Hsp92II CATG 1 cut(s) 186
Kzo9I GATC 1 cut(s) 448
LpnPI CCDG 7 cut(s) 201, 240, 267, 273, 285, 319, 405
Lsp1109I GCAGC 1 cut(s) 277
MaeI CTAG 2 cut(s) 120, 375
MaeII ACGT 2 cut(s) 239, 300
MaeIII GTNAC 1 cut(s) 225
MalI GATC 1 cut(s) 450
MboI GATC 1 cut(s) 448
MboII GAAGA 1 cut(s) 142
MhlI GDGCHC 1 cut(s) 254
MluCI AATT 8 cut(s) 75, 81, 104, 159, 212, 399, 432, 471
MnlI CCTC 2 cut(s) 182, 185
Mph1103I ATGCAT 1 cut(s) 184
MseI TTAA 3 cut(s) 381, 402, 484
MspR9I CCNGG 1 cut(s) 255
MvaI CCWGG 1 cut(s) 255
MwoI GCNNNNNNNGC 2 cut(s) 188, 371
NdeII GATC 1 cut(s) 448
NheI GCTAGC 1 cut(s) 374
NlaIII CATG 1 cut(s) 186
NlaIV GGNNCC 1 cut(s) 252
NsiI ATGCAT 1 cut(s) 184
NspI RCATGY 1 cut(s) 186
PkrI GCNGC 1 cut(s) 267
PmaCI CACGTG 1 cut(s) 301
PmlI CACGTG 1 cut(s) 301
Ppu21I YACGTR 1 cut(s) 301
Psp6I CCWGG 1 cut(s) 253
PspCI CACGTG 1 cut(s) 301
PspGI CCWGG 1 cut(s) 253
PspN4I GGNNCC 1 cut(s) 252
PspOMI GGGCCC 1 cut(s) 250
PspPI GGNCC 2 cut(s) 250, 251
SalI GTCGAC 2 cut(s) 386, 458
SaqAI TTAA 3 cut(s) 381, 402, 484
SatI GCNGC 1 cut(s) 266
Sau3AI GATC 1 cut(s) 448
Sau96I GGNCC 2 cut(s) 250, 251
ScrFI CCNGG 1 cut(s) 255
SduI GDGCHC 1 cut(s) 254
SetI ASST 8 cut(s) 34, 116, 232, 242, 292, 303, 316, 367
Sse9I AATT 8 cut(s) 75, 81, 104, 159, 212, 399, 432, 471
SspMI CTAG 2 cut(s) 120, 375
StyD4I CCNGG 1 cut(s) 253
StyI CCWWGG 1 cut(s) 32
TaaI ACNGT 2 cut(s) 166, 209
TaiI ACGT 2 cut(s) 242, 303
TaqI TCGA 2 cut(s) 387, 459
TasI AATT 8 cut(s) 75, 81, 104, 159, 212, 399, 432, 471
Tru1I TTAA 3 cut(s) 381, 402, 484
Tru9I TTAA 3 cut(s) 381, 402, 484
TseI GCWGC 1 cut(s) 265
TspDTI ATGAA 3 cut(s) 33, 75, 232
XagI CCTNNNNNAGG 1 cut(s) 258
XapI RAATTY 1 cut(s) 432
XceI RCATGY 1 cut(s) 186
XmiI GTMKAC 2 cut(s) 387, 459
XspI CTAG 2 cut(s) 120, 375
Zsp2I ATGCAT 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.