Rw5G010510

Belongs to the plant LTP family

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Forward (+)
11539948 .. 11540494
547 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G010510.1

Sequence Viewer

Length: 381 bp
ATGGAGAAGAAAATGATGACTTTCGCTGGGCTGGTGATTATGGTCGTCGTCCTCAATGTATGTCCTGCAATTGGAGGGTGCGACGCAGAATTAGTGAAGTTGTTGCCCTGTGCCACGTTCTTTATGGGCCCTGCCGTAGGGAAGGCCCCTCCTGAGTGCTGTGAAGGCGTAAAAAATGTGCTTGATGGAGCTGATACCAATGAGAAGCGCAGGAGTCTTTGCCAATGTTTGAAAGACACAGCTATTGGTGCTGAAGTTAAACTCACCCCTGAAAAACTTAAGAACGTTACTGACCCTTGTGGCGTTAATGATCCCAATTTCGACTGCAACACAATTCCGGTGTTTGAATGGGATCAAATAGAACTTGGAGAAGAAGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

126

Amino Acids

13.61

Weight (kDa)

4.51

Isoelectric Point (pI)

36.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LTP_2 PF14368 23 - 109 1.6e-06 Probable lipid transfer
Tryp_alpha_amyl PF00234 27 - 109 1.2e-09 Protease inhibitor/seed storage/LTP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 285
AclWI GGATC 2 cut(s) 305, 360
AcuI CTGAAG 1 cut(s) 273
AfiI CCNNNNNNNGG 2 cut(s) 71, 137
AflII CTTAAG 1 cut(s) 278
AgsI TTSAA 2 cut(s) 232, 347
AluBI AGCT 2 cut(s) 191, 242
AluI AGCT 2 cut(s) 191, 242
AlwI GGATC 2 cut(s) 305, 360
AoxI GGCC 2 cut(s) 127, 144
ApaI GGGCCC 1 cut(s) 131
AspLEI GCGC 1 cut(s) 210
AspS9I GGNCC 3 cut(s) 127, 128, 145
AsuHPI GGTGA 2 cut(s) 46, 256
BaeGI GKGCMC 1 cut(s) 131
BanII GRGCYC 1 cut(s) 131
BccI CCATC 1 cut(s) 179
BceAI ACGGC 1 cut(s) 119
BfrI CTTAAG 1 cut(s) 278
BmgT120I GGNCC 3 cut(s) 127, 128, 145
BmiI GGNNCC 2 cut(s) 129, 147
BsaWI WCCGGW 1 cut(s) 337
Bsc4I CCNNNNNNNGG 2 cut(s) 71, 137
BseLI CCNNNNNNNGG 2 cut(s) 71, 137
BseMII CTCAG 1 cut(s) 144
BseSI GKGCMC 1 cut(s) 131
BseYI CCCAGC 1 cut(s) 26
BshFI GGCC 2 cut(s) 129, 146
BsiSI CCGG 1 cut(s) 338
BslI CCNNNNNNNGG 2 cut(s) 71, 137
BsnI GGCC 2 cut(s) 129, 146
Bsp120I GGGCCC 1 cut(s) 127
Bsp1286I GDGCHC 1 cut(s) 131
Bsp143I GATC 2 cut(s) 310, 352
BspANI GGCC 2 cut(s) 129, 146
BspCNI CTCAG 1 cut(s) 145
BspLI GGNNCC 2 cut(s) 129, 147
BspPI GGATC 2 cut(s) 305, 360
BspTI CTTAAG 1 cut(s) 278
BssMI GATC 2 cut(s) 310, 352
BstAFI CTTAAG 1 cut(s) 278
BstDEI CTNAG 1 cut(s) 153
BstENI CCTNNNNNAGG 1 cut(s) 135
BstHHI GCGC 1 cut(s) 210
BstKTI GATC 2 cut(s) 313, 355
BstMBI GATC 2 cut(s) 310, 352
BstMWI GCNNNNNNNGC 2 cut(s) 165, 248
BstSLI GKGCMC 1 cut(s) 131
BsuRI GGCC 2 cut(s) 129, 146
CfoI GCGC 1 cut(s) 210
Cfr13I GGNCC 3 cut(s) 127, 128, 145
CseI GACGC 1 cut(s) 92
CviJI RGCY 5 cut(s) 31, 129, 146, 191, 242
CviKI_1 RGCY 5 cut(s) 31, 129, 146, 191, 242
DdeI CTNAG 1 cut(s) 153
DpnI GATC 2 cut(s) 312, 354
DpnII GATC 2 cut(s) 310, 352
Eco24I GRGCYC 1 cut(s) 131
Eco57I CTGAAG 1 cut(s) 273
EcoNI CCTNNNNNAGG 1 cut(s) 135
EcoO109I RGGNCCY 2 cut(s) 128, 145
EcoT38I GRGCYC 1 cut(s) 131
FaiI YATR 3 cut(s) 41, 61, 125
FriOI GRGCYC 1 cut(s) 131
GlaI GCGC 1 cut(s) 209
GsaI CCCAGC 1 cut(s) 30
HaeIII GGCC 2 cut(s) 129, 146
HapII CCGG 1 cut(s) 338
HgaI GACGC 1 cut(s) 92
HhaI GCGC 1 cut(s) 210
Hin6I GCGC 1 cut(s) 208
HinP1I GCGC 1 cut(s) 208
HinfI GANTC 1 cut(s) 214
HpaII CCGG 1 cut(s) 338
HphI GGTGA 2 cut(s) 46, 256
Hpy188III TCNNGA 1 cut(s) 152
Hpy99I CGWCG 2 cut(s) 50, 86
HpyAV CCTTC 2 cut(s) 136, 158
HpyCH4IV ACGT 2 cut(s) 116, 285
HpyCH4V TGCA 2 cut(s) 68, 327
HpyF10VI GCNNNNNNNGC 2 cut(s) 165, 248
HpyF3I CTNAG 1 cut(s) 153
HpySE526I ACGT 2 cut(s) 116, 285
HspAI GCGC 1 cut(s) 208
Kzo9I GATC 2 cut(s) 310, 352
LmnI GCTCC 1 cut(s) 188
LpnPI CCDG 9 cut(s) 12, 17, 78, 121, 144, 165, 196, 282, 351
MaeII ACGT 2 cut(s) 116, 285
MaeIII GTNAC 1 cut(s) 286
MalI GATC 2 cut(s) 312, 354
MboI GATC 2 cut(s) 310, 352
MboII GAAGA 1 cut(s) 19
MfeI CAATTG 1 cut(s) 69
MhlI GDGCHC 1 cut(s) 131
MluCI AATT 4 cut(s) 69, 89, 316, 333
MlyI GAGTC 1 cut(s) 223
MnlI CCTC 3 cut(s) 62, 68, 159
MseI TTAA 3 cut(s) 258, 279, 306
MspCI CTTAAG 1 cut(s) 278
MspI CCGG 1 cut(s) 338
MunI CAATTG 1 cut(s) 69
MwoI GCNNNNNNNGC 2 cut(s) 165, 248
NdeII GATC 2 cut(s) 310, 352
NlaIV GGNNCC 2 cut(s) 129, 147
PleI GAGTC 1 cut(s) 222
PpsI GAGTC 1 cut(s) 222
Psp1406I AACGTT 1 cut(s) 285
PspFI CCCAGC 1 cut(s) 26
PspN4I GGNNCC 2 cut(s) 129, 147
PspOMI GGGCCC 1 cut(s) 127
PspPI GGNCC 3 cut(s) 127, 128, 145
SaqAI TTAA 3 cut(s) 258, 279, 306
Sau3AI GATC 2 cut(s) 310, 352
Sau96I GGNCC 3 cut(s) 127, 128, 145
SchI GAGTC 1 cut(s) 223
SduI GDGCHC 1 cut(s) 131
SetI ASST 4 cut(s) 119, 193, 244, 288
SmlI CTYRAG 1 cut(s) 278
SmoI CTYRAG 1 cut(s) 278
Sse9I AATT 4 cut(s) 69, 89, 316, 333
TaiI ACGT 2 cut(s) 119, 288
TaqI TCGA 1 cut(s) 321
TasI AATT 4 cut(s) 69, 89, 316, 333
Tru1I TTAA 3 cut(s) 258, 279, 306
Tru9I TTAA 3 cut(s) 258, 279, 306
Vha464I CTTAAG 1 cut(s) 278
XagI CCTNNNNNAGG 1 cut(s) 135
XcmI CCANNNNNNNNNTGG 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.