Rmu_sc0008119.1_g000005

Belongs to the plant LTP family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008119.1
OG0004528
Physical Location & Seq
Forward (+)
19663 .. 19974
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008119.1_g000005.1.cds

Sequence Viewer

Length: 312 bp
atggtcgtcgtcctcaatgcatgtcctgcaattggaggatgcgacgaagccttagtcgagttgttgccctgtgccactttcgtgatgggtcctgcagaaggaactccccctcctgcatgttgtgaaggtatgcagcatgtcgttggtggagcagataccgttgagaagcgcaggagtctttgccaatgtttgaaagacacagctgttaaaaatgaggttaaaatcaagcctgaaaacattaagcatgctgttgatgcttgtggtgttaaaatccttgttcctattgatcctaatatcgactgcagcaagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LTP_2 Tryp_alpha_amyl

Protein Analysis

103

Amino Acids

10.79

Weight (kDa)

5.25

Isoelectric Point (pI)

53.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 281
AfiI CCNNNNNNNGG 2 cut(s) 32, 98
AgsI TTSAA 1 cut(s) 193
AleI CACNNNNGTG 1 cut(s) 80
AloI GAACNNNNNNTCC 2 cut(s) 94, 126
AluBI AGCT 1 cut(s) 203
AluI AGCT 1 cut(s) 203
AlwI GGATC 1 cut(s) 281
ApeKI GCWGC 2 cut(s) 133, 303
ArsI GACNNNNNNTTYG 2 cut(s) 39, 71
AspLEI GCGC 1 cut(s) 171
AspS9I GGNCC 1 cut(s) 89
AvaII GGWCC 1 cut(s) 89
BbvI GCAGC 1 cut(s) 145
BccI CCATC 1 cut(s) 79
BfmI CTRYAG 2 cut(s) 93, 301
BisI GCNGC 2 cut(s) 134, 304
BlsI GCNGC 2 cut(s) 135, 305
Bme18I GGWCC 1 cut(s) 89
BmgT120I GGNCC 1 cut(s) 89
BmiI GGNNCC 1 cut(s) 90
BmsI GCATC 2 cut(s) 29, 244
BsaXI ACNNNNNCTCC 2 cut(s) 94, 124
Bsc4I CCNNNNNNNGG 2 cut(s) 32, 98
BseGI GGATG 1 cut(s) 44
BseLI CCNNNNNNNGG 2 cut(s) 32, 98
BseXI GCAGC 1 cut(s) 145
BslI CCNNNNNNNGG 2 cut(s) 32, 98
Bsp143I GATC 1 cut(s) 286
BspLI GGNNCC 1 cut(s) 90
BspMAI CTGCAG 2 cut(s) 97, 305
BspPI GGATC 1 cut(s) 281
BssMI GATC 1 cut(s) 286
Bst4CI ACNGT 1 cut(s) 160
BstAPI GCANNNNNTGC 1 cut(s) 26
BstC8I GCNNGC 1 cut(s) 246
BstDEI CTNAG 1 cut(s) 52
BstENI CCTNNNNNAGG 1 cut(s) 96
BstF5I GGATG 1 cut(s) 44
BstHHI GCGC 1 cut(s) 171
BstKTI GATC 1 cut(s) 289
BstMBI GATC 1 cut(s) 286
BstMWI GCNNNNNNNGC 2 cut(s) 26, 254
BstNSI RCATGY 4 cut(s) 24, 120, 140, 248
BstSFI CTRYAG 2 cut(s) 93, 301
BstV1I GCAGC 1 cut(s) 145
BtsCI GGATG 1 cut(s) 44
Cac8I GCNNGC 1 cut(s) 246
CfoI GCGC 1 cut(s) 171
Cfr13I GGNCC 1 cut(s) 89
CviAII CATG 4 cut(s) 21, 117, 137, 245
CviJI RGCY 3 cut(s) 50, 203, 229
CviKI_1 RGCY 3 cut(s) 50, 203, 229
DdeI CTNAG 1 cut(s) 52
DpnI GATC 1 cut(s) 288
DpnII GATC 1 cut(s) 286
Eco47I GGWCC 1 cut(s) 89
EcoNI CCTNNNNNAGG 1 cut(s) 96
EcoO109I RGGNCCY 1 cut(s) 89
EcoT22I ATGCAT 1 cut(s) 22
FaeI CATG 4 cut(s) 24, 120, 140, 248
FaiI YATR 5 cut(s) 22, 118, 131, 138, 246
FatI CATG 4 cut(s) 20, 116, 136, 244
Fnu4HI GCNGC 2 cut(s) 134, 304
FokI GGATG 1 cut(s) 51
Fsp4HI GCNGC 2 cut(s) 134, 304
GlaI GCGC 1 cut(s) 170
GluI GCNGC 2 cut(s) 134, 304
HhaI GCGC 1 cut(s) 171
Hin1II CATG 4 cut(s) 24, 120, 140, 248
Hin6I GCGC 1 cut(s) 169
HinP1I GCGC 1 cut(s) 169
HinfI GANTC 1 cut(s) 175
Hpy188III TCNNGA 1 cut(s) 82
Hpy99I CGWCG 2 cut(s) 11, 47
HpyAV CCTTC 2 cut(s) 92, 119
HpyCH4III ACNGT 1 cut(s) 160
HpyCH4V TGCA 6 cut(s) 20, 29, 95, 116, 133, 303
HpyF10VI GCNNNNNNNGC 2 cut(s) 26, 254
HpyF3I CTNAG 1 cut(s) 52
Hsp92II CATG 4 cut(s) 24, 120, 140, 248
HspAI GCGC 1 cut(s) 169
Kzo9I GATC 1 cut(s) 286
LmnI GCTCC 1 cut(s) 149
LpnPI CCDG 6 cut(s) 39, 82, 105, 126, 157, 243
Lsp1109I GCAGC 1 cut(s) 145
LweI GCATC 2 cut(s) 29, 244
MalI GATC 1 cut(s) 288
MboI GATC 1 cut(s) 286
MfeI CAATTG 1 cut(s) 30
MluCI AATT 1 cut(s) 30
MlyI GAGTC 1 cut(s) 184
MnlI CCTC 4 cut(s) 23, 29, 120, 208
Mph1103I ATGCAT 1 cut(s) 22
MseI TTAA 4 cut(s) 207, 219, 240, 267
MslI CAYNNNNRTG 1 cut(s) 80
MspA1I CMGCKG 1 cut(s) 203
MunI CAATTG 1 cut(s) 30
MwoI GCNNNNNNNGC 2 cut(s) 26, 254
NdeII GATC 1 cut(s) 286
NlaIII CATG 4 cut(s) 24, 120, 140, 248
NlaIV GGNNCC 1 cut(s) 90
NsiI ATGCAT 1 cut(s) 22
NspI RCATGY 4 cut(s) 24, 120, 140, 248
OliI CACNNNNGTG 1 cut(s) 80
PaeI GCATGC 1 cut(s) 248
PkrI GCNGC 2 cut(s) 135, 305
PleI GAGTC 1 cut(s) 183
PpsI GAGTC 1 cut(s) 183
PpuMI RGGWCCY 1 cut(s) 89
Psp5II RGGWCCY 1 cut(s) 89
PspN4I GGNNCC 1 cut(s) 90
PspPI GGNCC 1 cut(s) 89
PspPPI RGGWCCY 1 cut(s) 89
PstI CTGCAG 2 cut(s) 97, 305
PvuII CAGCTG 1 cut(s) 203
RseI CAYNNNNRTG 1 cut(s) 80
SaqAI TTAA 4 cut(s) 207, 219, 240, 267
SatI GCNGC 2 cut(s) 134, 304
Sau3AI GATC 1 cut(s) 286
Sau96I GGNCC 1 cut(s) 89
SchI GAGTC 1 cut(s) 184
SetI ASST 3 cut(s) 130, 205, 219
SfaNI GCATC 2 cut(s) 29, 244
SfcI CTRYAG 2 cut(s) 93, 301
SinI GGWCC 1 cut(s) 89
SmiMI CAYNNNNRTG 1 cut(s) 80
SphI GCATGC 1 cut(s) 248
Sse9I AATT 1 cut(s) 30
TaaI ACNGT 1 cut(s) 160
TaqI TCGA 2 cut(s) 57, 297
TasI AATT 1 cut(s) 30
Tru1I TTAA 4 cut(s) 207, 219, 240, 267
Tru9I TTAA 4 cut(s) 207, 219, 240, 267
TseI GCWGC 2 cut(s) 133, 303
VpaK11BI GGWCC 1 cut(s) 89
XagI CCTNNNNNAGG 1 cut(s) 96
XceI RCATGY 4 cut(s) 24, 120, 140, 248
XcmI CCANNNNNNNNNTGG 1 cut(s) 82
Zsp2I ATGCAT 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.