FvH4_3g31814

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Reverse (-)
26771129 .. 26771476
348 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g31814.t1

Sequence Viewer

Length: 210 bp
ATGTCCGCACCGAAGAAAAAGTGCAGACGCCGGCTCAAGGAGGCTCTAGGCGGCGTCAATGGCAACTTTGATTCTGTCCTTGAAGACATCAAACATCCCAGACGTCGTCATCATCAAGGGACGTCAAGGTCGCCGACGCCGTCAACACCGCTTGGAGCTTTCTTGAGTCAGTGTCCGCACTTTTTCACCTTTGCAGATGTCCGCCGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.83

Weight (kDa)

11.22

Isoelectric Point (pI)

82.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 127
AatII GACGTC 2 cut(s) 106, 125
AciI CCGC 6 cut(s) 6, 51, 149, 176, 202, 205
AcyI GRCGYC 5 cut(s) 28, 54, 103, 122, 137
AfiI CCNNNNNNNGG 1 cut(s) 37
AgsI TTSAA 1 cut(s) 83
AluBI AGCT 1 cut(s) 158
AluI AGCT 1 cut(s) 158
AsuHPI GGTGA 1 cut(s) 178
BbsI GAAGAC 1 cut(s) 90
BceAI ACGGC 1 cut(s) 124
BfaI CTAG 1 cut(s) 47
BisI GCNGC 2 cut(s) 52, 205
BlsI GCNGC 2 cut(s) 53, 206
BpiI GAAGAC 1 cut(s) 90
BpuEI CTTGAG 2 cut(s) 20, 184
BsaHI GRCGYC 5 cut(s) 28, 54, 103, 122, 137
Bsc4I CCNNNNNNNGG 1 cut(s) 37
Bse118I RCCGGY 1 cut(s) 30
BseGI GGATG 1 cut(s) 94
BseLI CCNNNNNNNGG 1 cut(s) 37
BsgI GTGCAG 1 cut(s) 43
BsiSI CCGG 1 cut(s) 31
BslFI GGGAC 1 cut(s) 133
BslI CCNNNNNNNGG 1 cut(s) 37
BsmFI GGGAC 1 cut(s) 133
BspACI CCGC 6 cut(s) 6, 51, 149, 176, 202, 205
BsrFI RCCGGY 1 cut(s) 30
BssAI RCCGGY 1 cut(s) 30
BssNI GRCGYC 5 cut(s) 28, 54, 103, 122, 137
BstACI GRCGYC 5 cut(s) 28, 54, 103, 122, 137
BstC8I GCNNGC 1 cut(s) 32
BstF5I GGATG 1 cut(s) 94
BstMWI GCNNNNNNNGC 1 cut(s) 60
BstV2I GAAGAC 1 cut(s) 90
BtsCI GGATG 1 cut(s) 94
BtsIMutI CAGTG 1 cut(s) 176
Cac8I GCNNGC 1 cut(s) 32
Cfr10I RCCGGY 1 cut(s) 30
CseI GACGC 3 cut(s) 36, 43, 145
CviJI RGCY 3 cut(s) 34, 44, 158
CviKI_1 RGCY 3 cut(s) 34, 44, 158
DrdI GACNNNNNNGTC 1 cut(s) 127
DseDI GACNNNNNNGTC 1 cut(s) 127
EciI GGCGGA 1 cut(s) 191
FaqI GGGAC 1 cut(s) 133
Fnu4HI GCNGC 2 cut(s) 52, 205
FokI GGATG 1 cut(s) 81
Fsp4HI GCNGC 2 cut(s) 52, 205
FspBI CTAG 1 cut(s) 47
GluI GCNGC 2 cut(s) 52, 205
HapII CCGG 1 cut(s) 31
HgaI GACGC 3 cut(s) 36, 43, 145
Hin1I GRCGYC 5 cut(s) 28, 54, 103, 122, 137
HincII GTYRAC 1 cut(s) 144
HindII GTYRAC 1 cut(s) 144
HinfI GANTC 2 cut(s) 71, 166
HpaII CCGG 1 cut(s) 31
HphI GGTGA 1 cut(s) 178
Hpy166II GTNNAC 1 cut(s) 144
Hpy188III TCNNGA 1 cut(s) 163
Hpy8I GTNNAC 1 cut(s) 144
Hpy99I CGWCG 2 cut(s) 108, 139
HpyCH4IV ACGT 2 cut(s) 103, 122
HpyCH4V TGCA 2 cut(s) 24, 194
HpyF10VI GCNNNNNNNGC 1 cut(s) 60
HpySE526I ACGT 2 cut(s) 103, 122
Hsp92I GRCGYC 5 cut(s) 28, 54, 103, 122, 137
KroI GCCGGC 1 cut(s) 30
KroNI GCCGGC 1 cut(s) 32
LmnI GCTCC 1 cut(s) 155
LpnPI CCDG 2 cut(s) 44, 112
MaeI CTAG 1 cut(s) 47
MaeII ACGT 2 cut(s) 103, 122
MboII GAAGA 2 cut(s) 25, 95
MlyI GAGTC 1 cut(s) 175
MnlI CCTC 1 cut(s) 34
MroNI GCCGGC 1 cut(s) 30
MspA1I CMGCKG 1 cut(s) 207
MspI CCGG 1 cut(s) 31
MwoI GCNNNNNNNGC 1 cut(s) 60
NaeI GCCGGC 1 cut(s) 32
NgoMIV GCCGGC 1 cut(s) 30
PcsI WCGNNNNNNNCGW 1 cut(s) 137
PdiI GCCGGC 1 cut(s) 32
PfeI GAWTC 1 cut(s) 71
PflFI GACNNNGTC 2 cut(s) 105, 139
PkrI GCNGC 2 cut(s) 53, 206
PleI GAGTC 1 cut(s) 174
PpsI GAGTC 1 cut(s) 174
PsyI GACNNNGTC 2 cut(s) 105, 139
SatI GCNGC 2 cut(s) 52, 205
SchI GAGTC 1 cut(s) 175
SetI ASST 5 cut(s) 106, 125, 131, 160, 191
SgeI CNNG 9 cut(s) 43, 49, 59, 92, 111, 128, 138, 164, 175
SmlI CTYRAG 2 cut(s) 35, 163
SmoI CTYRAG 2 cut(s) 35, 163
SsiI CCGC 6 cut(s) 6, 51, 149, 176, 202, 205
SspMI CTAG 1 cut(s) 47
TaiI ACGT 2 cut(s) 106, 125
TauI GCSGC 2 cut(s) 54, 207
TfiI GAWTC 1 cut(s) 71
TscAI CASTG 1 cut(s) 176
TspRI CASTG 1 cut(s) 176
Tth111I GACNNNGTC 2 cut(s) 105, 139
XspI CTAG 1 cut(s) 47
ZraI GACGTC 2 cut(s) 104, 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.