MD13G1110600.v1.1

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
Physical Location & Seq
Reverse (-)
8035859 .. 8036379
521 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1110600.v1.1.491

Sequence Viewer

Length: 171 bp
ATGCATCAGGATAATAGTGGATCTGTAGCCGTGGAGGCACTACAGGAGCTTTTTACTGGTGATGGACAGTCTAAGAAGGGACGAAGAGGGCAAAACGAGGTGTTACGAAGATATGCCGCTTCAAGAAATGCAAGCAACTCAGGAGCAACAGACCATTCAAAAAATTTTTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.08

Weight (kDa)

9.52

Isoelectric Point (pI)

64.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 117
AclWI GGATC 1 cut(s) 28
AcsI RAATTY 1 cut(s) 163
AgsI TTSAA 2 cut(s) 123, 159
AluBI AGCT 1 cut(s) 49
AluI AGCT 1 cut(s) 49
AlwI GGATC 1 cut(s) 28
ApoI RAATTY 1 cut(s) 163
AsuHPI GGTGA 1 cut(s) 71
BccI CCATC 1 cut(s) 56
BceAI ACGGC 1 cut(s) 14
BfmI CTRYAG 2 cut(s) 24, 41
BglI GCCNNNNNGGC 1 cut(s) 35
BisI GCNGC 1 cut(s) 117
BlsI GCNGC 1 cut(s) 118
BmsI GCATC 1 cut(s) 13
BsaJI CCNNGG 1 cut(s) 30
Bse1I ACTGG 1 cut(s) 61
BseDI CCNNGG 1 cut(s) 30
BseMII CTCAG 1 cut(s) 153
BseNI ACTGG 1 cut(s) 61
BslFI GGGAC 1 cut(s) 93
BsmFI GGGAC 1 cut(s) 93
Bsp143I GATC 1 cut(s) 20
BspACI CCGC 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 152
BspPI GGATC 1 cut(s) 28
BsrI ACTGG 1 cut(s) 61
BssECI CCNNGG 1 cut(s) 30
BssMI GATC 1 cut(s) 20
Bst4CI ACNGT 1 cut(s) 69
Bst6I CTCTTC 1 cut(s) 79
BstC8I GCNNGC 1 cut(s) 133
BstDEI CTNAG 2 cut(s) 72, 139
BstDSI CCRYGG 1 cut(s) 30
BstKTI GATC 1 cut(s) 23
BstMBI GATC 1 cut(s) 20
BstMWI GCNNNNNNNGC 1 cut(s) 35
BstSFI CTRYAG 2 cut(s) 24, 41
BstX2I RGATCY 1 cut(s) 20
BstYI RGATCY 1 cut(s) 20
BtgI CCRYGG 1 cut(s) 30
Cac8I GCNNGC 1 cut(s) 133
CviJI RGCY 2 cut(s) 29, 49
CviKI_1 RGCY 2 cut(s) 29, 49
DdeI CTNAG 2 cut(s) 72, 139
DpnI GATC 1 cut(s) 22
DpnII GATC 1 cut(s) 20
Eam1104I CTCTTC 1 cut(s) 79
EarI CTCTTC 1 cut(s) 79
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 1 cut(s) 114
FaqI GGGAC 1 cut(s) 93
Fnu4HI GCNGC 1 cut(s) 117
Fsp4HI GCNGC 1 cut(s) 117
GluI GCNGC 1 cut(s) 117
HphI GGTGA 1 cut(s) 71
Hpy188III TCNNGA 3 cut(s) 8, 123, 141
HpyAV CCTTC 1 cut(s) 70
HpyCH4III ACNGT 1 cut(s) 69
HpyCH4V TGCA 2 cut(s) 4, 131
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
HpyF3I CTNAG 2 cut(s) 72, 139
Kzo9I GATC 1 cut(s) 20
LmnI GCTCC 2 cut(s) 46, 143
LpnPI CCDG 3 cut(s) 29, 42, 126
LweI GCATC 1 cut(s) 13
MaeIII GTNAC 1 cut(s) 102
MalI GATC 1 cut(s) 22
MboI GATC 1 cut(s) 20
MboII GAAGA 2 cut(s) 96, 120
MflI RGATCY 1 cut(s) 20
MluCI AATT 1 cut(s) 163
MnlI CCTC 3 cut(s) 28, 80, 91
Mph1103I ATGCAT 1 cut(s) 6
MwoI GCNNNNNNNGC 1 cut(s) 35
NdeII GATC 1 cut(s) 20
NsiI ATGCAT 1 cut(s) 6
PkrI GCNGC 1 cut(s) 118
PsuI RGATCY 1 cut(s) 20
SatI GCNGC 1 cut(s) 117
Sau3AI GATC 1 cut(s) 20
SetI ASST 2 cut(s) 51, 102
SfaNI GCATC 1 cut(s) 13
SfcI CTRYAG 2 cut(s) 24, 41
SgeI CNNG 8 cut(s) 20, 43, 56, 69, 109, 135, 144, 153
Sse9I AATT 1 cut(s) 163
SsiI CCGC 1 cut(s) 117
TaaI ACNGT 1 cut(s) 69
TasI AATT 1 cut(s) 163
TauI GCSGC 1 cut(s) 119
XapI RAATTY 1 cut(s) 163
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.