Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb6

Orthogroup ID

OG0005858

Physical Location & Seq

Genomic Coordinates Reverse (-)

24042809 .. 24043367

Gene Structure 559 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_6g30873.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 339 bp

ATGGAAATCTATAAGAAAAGGCCAGATCATCATGTAATTAACTTGGAAGAACCAGTGAGGAAAATAGATGGAGTTTATGATCTGTTTAGTGGAAAAGCGAGTCAGGATGGTCGTGTTTTTAAACAGAACTTTGCAATTCGATCGTATGAAGTAGGATGTGATGGAAAAGCAAGCATGGGGTCCTTTATGAAACGCTTGCAGGAAATAGTGGTTCAGCATAGCAAGAGTATTGGACTCTTATCTGGTGGTTTCTGTTCAACACCAGAGATGGAGAAAAGGGGTCTTGTATGGGTGCTCCGTAAGTTGCAGATTGATGTGGAACAATATCCTTCCTGGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00061 ko01100 ko01212 map00061 map01100 map01212

Pfam Domains

Protein Families

Acyl-ACP_TE

Protein Analysis

113

Amino Acids

12.85

Weight (kDa)

8.93

Isoelectric Point (pI)

48.47

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Acyl-ACP_TE	PF01643	37 - 112	1e-14	Acyl-ACP thioesterase N-terminal domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005858)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G08510
fragaria_vesca	FvH4_1g04250 FvH4_1g04250 FvH4_1g04250 FvH4_6g30873
malus_domestica	MD02G1042500.v1.1 MD02G1062000.v1.1 MD09G1215700.v1.1
prunus_persica	Prupe.3G074600_v2.0.a1 Prupe.3G074600_v2.0.a1 Prupe.3G074700_v2.0.a1 Prupe.7G234600_v2.0.a1 Prupe.7G234600_v2.0.a1 Prupe.7G234600_v2.0.a1
pyrus_communis	pycom02g03520 pycom15g16310
rosa_chinensis	RchiOBHm_Chr2g0089811
rosa_laevigata	RLG00000016057
rosa_multiflora	Rmu_sc0000665.1_g000007
rosa_roxburghii	Rroxscaffold_2G00151600
rosa_rugosa	Rorug02G0003400 Rorug02G0003500
rosa_samantha	Rh2AG048600 Rh2AG389900 Rh2BG047400 Rh2CG049500 Rh2CG377400
rosa_wichuraiana	Rw2G004180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	258
AjnI	CCWGG	1 cut(s)	332
Alw21I	GWGCWC	1 cut(s)	297
AoxI	GGCC	1 cut(s)	20
AspS9I	GGNCC	1 cut(s)	180
AvaII	GGWCC	1 cut(s)	180
Bbv12I	GWGCWC	1 cut(s)	297
BccI	CCATC	4 cut(s)	62, 101, 155, 262
BcgI	CGANNNNNNTGC	2 cut(s)	123, 157
BciT130I	CCWGG	1 cut(s)	334
Bme1390I	CCNGG	1 cut(s)	334
Bme18I	GGWCC	1 cut(s)	180
BmgT120I	GGNCC	1 cut(s)	180
BmiI	GGNNCC	1 cut(s)	181
BmrFI	CCNGG	1 cut(s)	334
Bse1I	ACTGG	1 cut(s)	53
BseBI	CCWGG	1 cut(s)	334
BseGI	GGATG	2 cut(s)	112, 161
BseNI	ACTGG	1 cut(s)	53
Bsh1285I	CGRYCG	1 cut(s)	143
BshFI	GGCC	1 cut(s)	22
BsiEI	CGRYCG	1 cut(s)	143
BsiHKAI	GWGCWC	1 cut(s)	297
BsnI	GGCC	1 cut(s)	22
Bsp1286I	GDGCHC	1 cut(s)	297
Bsp143I	GATC	3 cut(s)	25, 79, 140
BspANI	GGCC	1 cut(s)	22
BspLI	GGNNCC	1 cut(s)	181
BsrI	ACTGG	1 cut(s)	53
BssMI	GATC	3 cut(s)	25, 79, 140
Bst2UI	CCWGG	1 cut(s)	334
BstC8I	GCNNGC	2 cut(s)	172, 197
BstF5I	GGATG	2 cut(s)	112, 161
BstKTI	GATC	3 cut(s)	28, 82, 143
BstMBI	GATC	3 cut(s)	25, 79, 140
BstMCI	CGRYCG	1 cut(s)	143
BstNI	CCWGG	1 cut(s)	334
BstSCI	CCNGG	1 cut(s)	332
BsuRI	GGCC	1 cut(s)	22
BtsCI	GGATG	2 cut(s)	112, 161
BtsIMutI	CAGTG	1 cut(s)	60
Cac8I	GCNNGC	2 cut(s)	172, 197
Cfr13I	GGNCC	1 cut(s)	180
CviAII	CATG	2 cut(s)	32, 175
CviJI	RGCY	1 cut(s)	22
CviKI_1	RGCY	1 cut(s)	22
DpnI	GATC	3 cut(s)	27, 81, 142
DpnII	GATC	3 cut(s)	25, 79, 140
DraI	TTTAAA	1 cut(s)	121
Eco47I	GGWCC	1 cut(s)	180
EcoO109I	RGGNCCY	1 cut(s)	180
EcoRII	CCWGG	1 cut(s)	332
FaeI	CATG	2 cut(s)	35, 178
FaiI	YATR	8 cut(s)	12, 33, 78, 147, 176, 188, 219, 289
FatI	CATG	2 cut(s)	31, 174
FokI	GGATG	2 cut(s)	119, 168
HaeIII	GGCC	1 cut(s)	22
Hin1II	CATG	2 cut(s)	35, 178
HinfI	GANTC	2 cut(s)	100, 234
Hpy188III	TCNNGA	1 cut(s)	104
HpyAV	CCTTC	1 cut(s)	339
HpyCH4V	TGCA	3 cut(s)	134, 199, 307
Hsp92II	CATG	2 cut(s)	35, 178
Kzo9I	GATC	3 cut(s)	25, 79, 140
LmnI	GCTCC	1 cut(s)	300
LpnPI	CCDG	7 cut(s)	36, 66, 89, 185, 228, 276, 319
MalI	GATC	3 cut(s)	27, 81, 142
MboI	GATC	3 cut(s)	25, 79, 140
MboII	GAAGA	1 cut(s)	59
MhlI	GDGCHC	1 cut(s)	297
MluCI	AATT	2 cut(s)	36, 135
MlyI	GAGTC	2 cut(s)	109, 228
MnlI	CCTC	1 cut(s)	51
MseI	TTAA	2 cut(s)	39, 120
MspR9I	CCNGG	1 cut(s)	334
MvaI	CCWGG	1 cut(s)	334
NdeII	GATC	3 cut(s)	25, 79, 140
NlaIII	CATG	2 cut(s)	35, 178
NlaIV	GGNNCC	1 cut(s)	181
Ple19I	CGATCG	1 cut(s)	143
PleI	GAGTC	2 cut(s)	108, 228
PpsI	GAGTC	2 cut(s)	108, 228
PpuMI	RGGWCCY	1 cut(s)	180
Psp5II	RGGWCCY	1 cut(s)	180
Psp6I	CCWGG	1 cut(s)	332
PspGI	CCWGG	1 cut(s)	332
PspN4I	GGNNCC	1 cut(s)	181
PspPI	GGNCC	1 cut(s)	180
PspPPI	RGGWCCY	1 cut(s)	180
PvuI	CGATCG	1 cut(s)	143
SaqAI	TTAA	2 cut(s)	39, 120
Sau3AI	GATC	3 cut(s)	25, 79, 140
Sau96I	GGNCC	1 cut(s)	180
SchI	GAGTC	2 cut(s)	109, 228
ScrFI	CCNGG	1 cut(s)	334
SduI	GDGCHC	1 cut(s)	297
SinI	GGWCC	1 cut(s)	180
Sse9I	AATT	2 cut(s)	36, 135
StyD4I	CCNGG	1 cut(s)	332
TaqI	TCGA	1 cut(s)	139
TasI	AATT	2 cut(s)	36, 135
Tru1I	TTAA	2 cut(s)	39, 120
Tru9I	TTAA	2 cut(s)	39, 120
TscAI	CASTG	1 cut(s)	60
TspDTI	ATGAA	2 cut(s)	162, 203
TspGWI	ACGGA	1 cut(s)	287
TspRI	CASTG	1 cut(s)	60
VpaK11BI	GGWCC	1 cut(s)	180

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.