Rh2CG377400

Plays an essential role in chain termination during de novo fatty acid synthesis

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
51404494 .. 51404817
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG377400.1

Sequence Viewer

Length: 324 bp
ATGGTACATGCTCTTGCTGCACCAAAGTTTTTCATGCCGAGGTTGCAATCAACCTTTCCTTGTTCAAAGAAACCATGTTCTGGAGGTAAAGGAAATAATAACTCTGCATTTGTTACTAACATTCATGGTAAAGAAGACACAGAAGCTGCTGCTAAGAGGAAGTTTGATCGGGTTTGTGACACTTTTGGTGAAAAATCAATTCAGGATGGTCGTGTTTTTATACACAACTTTGCAATTAGATCGTATGACTTGGGCCTTGATGGAAAAGCAAGTTTAAGCTCCATGATGAAACATGTACAGGTACGTAGGTGGTACTTTGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

11.99

Weight (kDa)

9.76

Isoelectric Point (pI)

50.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 80
AfaI GTAC 4 cut(s) 6, 297, 303, 314
AfiI CCNNNNNNNGG 1 cut(s) 80
AflIII ACRYGT 1 cut(s) 292
AgsI TTSAA 1 cut(s) 66
AluBI AGCT 2 cut(s) 146, 279
AluI AGCT 2 cut(s) 146, 279
AlwNI CAGNNNCTG 1 cut(s) 146
AoxI GGCC 1 cut(s) 253
ApeKI GCWGC 3 cut(s) 17, 146, 149
AspS9I GGNCC 1 cut(s) 253
AsuHPI GGTGA 1 cut(s) 200
BaeI ACNNNNGTAYC 2 cut(s) 293, 304
BbsI GAAGAC 1 cut(s) 141
BbvI GCAGC 3 cut(s) 4, 133, 136
BccI CCATC 2 cut(s) 200, 254
BcgI CGANNNNNNTGC 2 cut(s) 222, 256
BisI GCNGC 3 cut(s) 18, 147, 150
BlsI GCNGC 3 cut(s) 19, 148, 151
BmgT120I GGNCC 1 cut(s) 253
BpiI GAAGAC 1 cut(s) 141
BpmI CTGGAG 1 cut(s) 102
BsaAI YACGTR 1 cut(s) 305
BsaJI CCNNGG 1 cut(s) 38
Bsc4I CCNNNNNNNGG 1 cut(s) 80
BseDI CCNNGG 1 cut(s) 38
BseGI GGATG 1 cut(s) 211
BseLI CCNNNNNNNGG 1 cut(s) 80
BseXI GCAGC 3 cut(s) 4, 133, 136
BshFI GGCC 1 cut(s) 255
BslI CCNNNNNNNGG 1 cut(s) 80
BsnI GGCC 1 cut(s) 255
Bsp1407I TGTACA 1 cut(s) 295
Bsp143I GATC 2 cut(s) 166, 239
BspANI GGCC 1 cut(s) 255
BsrGI TGTACA 1 cut(s) 295
BssECI CCNNGG 1 cut(s) 38
BssMI GATC 2 cut(s) 166, 239
BstAUI TGTACA 1 cut(s) 295
BstBAI YACGTR 1 cut(s) 305
BstDEI CTNAG 1 cut(s) 153
BstF5I GGATG 1 cut(s) 211
BstKTI GATC 2 cut(s) 169, 242
BstMBI GATC 2 cut(s) 166, 239
BstMWI GCNNNNNNNGC 2 cut(s) 17, 43
BstNSI RCATGY 2 cut(s) 11, 296
BstSNI TACGTA 1 cut(s) 305
BstV1I GCAGC 3 cut(s) 4, 133, 136
BstV2I GAAGAC 1 cut(s) 141
BsuRI GGCC 1 cut(s) 255
BtsCI GGATG 1 cut(s) 211
CaiI CAGNNNCTG 1 cut(s) 146
Cfr13I GGNCC 1 cut(s) 253
Csp6I GTAC 4 cut(s) 5, 296, 302, 313
CviAII CATG 6 cut(s) 8, 34, 75, 125, 283, 293
CviJI RGCY 3 cut(s) 146, 255, 279
CviKI_1 RGCY 3 cut(s) 146, 255, 279
CviQI GTAC 4 cut(s) 5, 296, 302, 313
DdeI CTNAG 1 cut(s) 153
DpnI GATC 2 cut(s) 168, 241
DpnII GATC 2 cut(s) 166, 239
Eco105I TACGTA 1 cut(s) 305
FaeI CATG 6 cut(s) 11, 37, 78, 128, 286, 296
FaiI YATR 8 cut(s) 9, 35, 76, 126, 221, 246, 284, 294
FatI CATG 6 cut(s) 7, 33, 74, 124, 282, 292
Fnu4HI GCNGC 3 cut(s) 18, 147, 150
FokI GGATG 1 cut(s) 218
Fsp4HI GCNGC 3 cut(s) 18, 147, 150
GluI GCNGC 3 cut(s) 18, 147, 150
GsuI CTGGAG 1 cut(s) 102
HaeIII GGCC 1 cut(s) 255
Hin1II CATG 6 cut(s) 11, 37, 78, 128, 286, 296
HphI GGTGA 1 cut(s) 200
Hpy188III TCNNGA 2 cut(s) 81, 203
HpyCH4IV ACGT 1 cut(s) 304
HpyCH4V TGCA 4 cut(s) 20, 46, 107, 233
HpyF10VI GCNNNNNNNGC 2 cut(s) 17, 43
HpyF3I CTNAG 1 cut(s) 153
HpySE526I ACGT 1 cut(s) 304
Hsp92II CATG 6 cut(s) 11, 37, 78, 128, 286, 296
Kzo9I GATC 2 cut(s) 166, 239
LmnI GCTCC 1 cut(s) 284
LpnPI CCDG 3 cut(s) 66, 188, 284
Lsp1109I GCAGC 3 cut(s) 4, 133, 136
MaeII ACGT 1 cut(s) 304
MaeIII GTNAC 2 cut(s) 112, 176
MalI GATC 2 cut(s) 168, 241
MboI GATC 2 cut(s) 166, 239
MboII GAAGA 1 cut(s) 146
MluCI AATT 2 cut(s) 198, 234
MnlI CCTC 3 cut(s) 33, 77, 150
MseI TTAA 1 cut(s) 275
MwoI GCNNNNNNNGC 2 cut(s) 17, 43
NdeII GATC 2 cut(s) 166, 239
NlaIII CATG 6 cut(s) 11, 37, 78, 128, 286, 296
NmeAIII GCCGAG 1 cut(s) 63
NmuCI GTSAC 1 cut(s) 176
NspI RCATGY 2 cut(s) 11, 296
PciI ACATGT 1 cut(s) 292
PflMI CCANNNNNTGG 1 cut(s) 80
PkrI GCNGC 3 cut(s) 19, 148, 151
Ppu21I YACGTR 1 cut(s) 305
PscI ACATGT 1 cut(s) 292
PspPI GGNCC 1 cut(s) 253
PstNI CAGNNNCTG 1 cut(s) 146
RsaI GTAC 4 cut(s) 6, 297, 303, 314
RsaNI GTAC 4 cut(s) 5, 296, 302, 313
SaqAI TTAA 1 cut(s) 275
SatI GCNGC 3 cut(s) 18, 147, 150
Sau3AI GATC 2 cut(s) 166, 239
Sau96I GGNCC 1 cut(s) 253
SetI ASST 8 cut(s) 44, 56, 88, 148, 281, 303, 307, 311
SnaBI TACGTA 1 cut(s) 305
Sse9I AATT 2 cut(s) 198, 234
TaiI ACGT 1 cut(s) 307
TasI AATT 2 cut(s) 198, 234
TatI WGTACW 1 cut(s) 295
Tru1I TTAA 1 cut(s) 275
Tru9I TTAA 1 cut(s) 275
TseFI GTSAC 1 cut(s) 176
TseI GCWGC 3 cut(s) 17, 146, 149
Tsp45I GTSAC 1 cut(s) 176
TspDTI ATGAA 3 cut(s) 22, 113, 302
Van91I CCANNNNNTGG 1 cut(s) 80
XceI RCATGY 2 cut(s) 11, 296
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.