Rh2AG389900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
58418088 .. 58427548
9461 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG389900.1

Sequence Viewer

Length: 174 bp
ATGGTACATGCTCTTGCTGCACCAAAGTTTTTCATGCCGAGGTTGCAATCAACCTTTCCTTGTTCAAAGAAACCATGTTCTGGAGGTAAAGGAAATAATAACTCTGCATTTGTTACTAACATTCATGGTAAAGAAGACACAGAAGCTGCTGCTAAGAGGAAGTTTGATCGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.24

Weight (kDa)

9.92

Isoelectric Point (pI)

45.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 80
AfaI GTAC 1 cut(s) 6
AfiI CCNNNNNNNGG 1 cut(s) 80
AgsI TTSAA 1 cut(s) 66
AluBI AGCT 1 cut(s) 146
AluI AGCT 1 cut(s) 146
AlwNI CAGNNNCTG 1 cut(s) 146
ApeKI GCWGC 3 cut(s) 17, 146, 149
BbsI GAAGAC 1 cut(s) 141
BbvI GCAGC 3 cut(s) 4, 133, 136
BisI GCNGC 3 cut(s) 18, 147, 150
BlsI GCNGC 3 cut(s) 19, 148, 151
BpiI GAAGAC 1 cut(s) 141
BpmI CTGGAG 1 cut(s) 102
BsaJI CCNNGG 1 cut(s) 38
Bsc4I CCNNNNNNNGG 1 cut(s) 80
BseDI CCNNGG 1 cut(s) 38
BseLI CCNNNNNNNGG 1 cut(s) 80
BseXI GCAGC 3 cut(s) 4, 133, 136
BslI CCNNNNNNNGG 1 cut(s) 80
Bsp143I GATC 1 cut(s) 166
BssECI CCNNGG 1 cut(s) 38
BssMI GATC 1 cut(s) 166
BstDEI CTNAG 1 cut(s) 153
BstKTI GATC 1 cut(s) 169
BstMBI GATC 1 cut(s) 166
BstMWI GCNNNNNNNGC 2 cut(s) 17, 43
BstNSI RCATGY 1 cut(s) 11
BstV1I GCAGC 3 cut(s) 4, 133, 136
BstV2I GAAGAC 1 cut(s) 141
CaiI CAGNNNCTG 1 cut(s) 146
Csp6I GTAC 1 cut(s) 5
CviAII CATG 4 cut(s) 8, 34, 75, 125
CviJI RGCY 1 cut(s) 146
CviKI_1 RGCY 1 cut(s) 146
CviQI GTAC 1 cut(s) 5
DdeI CTNAG 1 cut(s) 153
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
FaeI CATG 4 cut(s) 11, 37, 78, 128
FaiI YATR 4 cut(s) 9, 35, 76, 126
FatI CATG 4 cut(s) 7, 33, 74, 124
Fnu4HI GCNGC 3 cut(s) 18, 147, 150
Fsp4HI GCNGC 3 cut(s) 18, 147, 150
GluI GCNGC 3 cut(s) 18, 147, 150
GsuI CTGGAG 1 cut(s) 102
Hin1II CATG 4 cut(s) 11, 37, 78, 128
Hpy188III TCNNGA 1 cut(s) 81
HpyCH4V TGCA 3 cut(s) 20, 46, 107
HpyF10VI GCNNNNNNNGC 2 cut(s) 17, 43
HpyF3I CTNAG 1 cut(s) 153
Hsp92II CATG 4 cut(s) 11, 37, 78, 128
Kzo9I GATC 1 cut(s) 166
LpnPI CCDG 1 cut(s) 66
Lsp1109I GCAGC 3 cut(s) 4, 133, 136
MaeIII GTNAC 1 cut(s) 112
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MboII GAAGA 1 cut(s) 146
MnlI CCTC 3 cut(s) 33, 77, 150
MwoI GCNNNNNNNGC 2 cut(s) 17, 43
NdeII GATC 1 cut(s) 166
NlaIII CATG 4 cut(s) 11, 37, 78, 128
NmeAIII GCCGAG 1 cut(s) 63
NspI RCATGY 1 cut(s) 11
PflMI CCANNNNNTGG 1 cut(s) 80
PkrI GCNGC 3 cut(s) 19, 148, 151
PstNI CAGNNNCTG 1 cut(s) 146
RsaI GTAC 1 cut(s) 6
RsaNI GTAC 1 cut(s) 5
SatI GCNGC 3 cut(s) 18, 147, 150
Sau3AI GATC 1 cut(s) 166
SetI ASST 4 cut(s) 44, 56, 88, 148
SgeI CNNG 8 cut(s) 20, 26, 46, 51, 72, 87, 93, 137
TseI GCWGC 3 cut(s) 17, 146, 149
TspDTI ATGAA 2 cut(s) 22, 113
Van91I CCANNNNNTGG 1 cut(s) 80
XceI RCATGY 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.