MD00G1054400.v1.1

zinc finger

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Reverse (-)
10126997 .. 10127436
440 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1054400.v1.1.491

Sequence Viewer

Length: 270 bp
ATGTTAAAGCGGCGATTCTACAAGCTAGAACACGGCGACAGAGATGGCCCCTCGAATTTGTCTTCATCCTCGTCGGATTCTGAAATAGAACCACACGCCACATACGACTCCGATGAGGAAGAAGAAGAATATGATGCAGTCGAACAACTCAAGGACGATGCTCAATCTTGCTCTACCTCCTCTGGATATCAGAGTGAGGATAGCTCAGCGAATGAAGTTCCTGTTGACTCCTCAGGTAAGGCTATAAGAATTTTTATCGGTGAATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

9.89

Weight (kDa)

4.2

Isoelectric Point (pI)

95.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 10
AcsI RAATTY 3 cut(s) 55, 249, 263
AluBI AGCT 2 cut(s) 25, 204
AluI AGCT 2 cut(s) 25, 204
AoxI GGCC 1 cut(s) 46
ApoI RAATTY 3 cut(s) 55, 249, 263
AspS9I GGNCC 1 cut(s) 47
AxyI CCTNAGG 1 cut(s) 232
BbsI GAAGAC 1 cut(s) 54
BccI CCATC 1 cut(s) 38
BceAI ACGGC 1 cut(s) 49
BfaI CTAG 1 cut(s) 26
BisI GCNGC 1 cut(s) 11
BlpI GCTNAGC 1 cut(s) 205
BlsI GCNGC 1 cut(s) 12
BmgT120I GGNCC 1 cut(s) 47
BmiI GGNNCC 1 cut(s) 49
BmsI GCATC 2 cut(s) 124, 148
BpiI GAAGAC 1 cut(s) 54
BplI GAGNNNNNCTC 2 cut(s) 188, 220
Bpu1102I GCTNAGC 1 cut(s) 205
BpuEI CTTGAG 1 cut(s) 134
Bse21I CCTNAGG 1 cut(s) 232
BseGI GGATG 1 cut(s) 65
BseMII CTCAG 2 cut(s) 219, 246
BseRI GAGGAG 2 cut(s) 169, 220
BshFI GGCC 1 cut(s) 48
BsnI GGCC 1 cut(s) 48
Bsp1720I GCTNAGC 1 cut(s) 205
BspACI CCGC 1 cut(s) 10
BspANI GGCC 1 cut(s) 48
BspCNI CTCAG 2 cut(s) 218, 245
BspLI GGNNCC 1 cut(s) 49
BstDEI CTNAG 2 cut(s) 205, 232
BstF5I GGATG 1 cut(s) 65
BstV2I GAAGAC 1 cut(s) 54
Bsu36I CCTNAGG 1 cut(s) 232
BsuRI GGCC 1 cut(s) 48
BtsCI GGATG 1 cut(s) 65
Cfr13I GGNCC 1 cut(s) 47
CviJI RGCY 4 cut(s) 25, 48, 204, 242
CviKI_1 RGCY 4 cut(s) 25, 48, 204, 242
DdeI CTNAG 2 cut(s) 205, 232
Eco32I GATATC 1 cut(s) 188
Eco81I CCTNAGG 1 cut(s) 232
EcoRV GATATC 1 cut(s) 188
FaiI YATR 3 cut(s) 103, 132, 245
Fnu4HI GCNGC 1 cut(s) 11
FokI GGATG 1 cut(s) 52
Fsp4HI GCNGC 1 cut(s) 11
FspBI CTAG 1 cut(s) 26
GluI GCNGC 1 cut(s) 11
HaeIII GGCC 1 cut(s) 48
HincII GTYRAC 1 cut(s) 226
HindII GTYRAC 1 cut(s) 226
HinfI GANTC 4 cut(s) 15, 77, 107, 227
Hpy166II GTNNAC 1 cut(s) 226
Hpy188I TCNGA 4 cut(s) 76, 82, 112, 192
Hpy188III TCNNGA 1 cut(s) 183
Hpy8I GTNNAC 1 cut(s) 226
Hpy99I CGWCG 1 cut(s) 76
HpyCH4V TGCA 1 cut(s) 137
HpyF3I CTNAG 2 cut(s) 205, 232
LpnPI CCDG 3 cut(s) 168, 219, 234
LweI GCATC 2 cut(s) 124, 148
MaeI CTAG 1 cut(s) 26
MboII GAAGA 4 cut(s) 54, 131, 134, 137
MluCI AATT 3 cut(s) 55, 249, 263
MlyI GAGTC 2 cut(s) 101, 221
MmeI TCCRAC 1 cut(s) 54
MnlI CCTC 7 cut(s) 61, 79, 109, 187, 190, 190, 241
MseI TTAA 1 cut(s) 5
NlaIV GGNNCC 1 cut(s) 49
PcsI WCGNNNNNNNCGW 1 cut(s) 102
PfeI GAWTC 2 cut(s) 15, 77
PkrI GCNGC 1 cut(s) 12
PleI GAGTC 2 cut(s) 101, 221
PpsI GAGTC 2 cut(s) 101, 221
PspN4I GGNNCC 1 cut(s) 49
PspPI GGNCC 1 cut(s) 47
SaqAI TTAA 1 cut(s) 5
SatI GCNGC 1 cut(s) 11
Sau96I GGNCC 1 cut(s) 47
SchI GAGTC 2 cut(s) 101, 221
SetI ASST 4 cut(s) 27, 179, 206, 238
SfaNI GCATC 2 cut(s) 124, 148
SmlI CTYRAG 1 cut(s) 149
SmoI CTYRAG 1 cut(s) 149
Sse9I AATT 3 cut(s) 55, 249, 263
SsiI CCGC 1 cut(s) 10
SspMI CTAG 1 cut(s) 26
TaqI TCGA 2 cut(s) 53, 141
TasI AATT 3 cut(s) 55, 249, 263
TauI GCSGC 1 cut(s) 13
TfiI GAWTC 2 cut(s) 15, 77
Tru1I TTAA 1 cut(s) 5
Tru9I TTAA 1 cut(s) 5
TspDTI ATGAA 2 cut(s) 54, 228
XapI RAATTY 3 cut(s) 55, 249, 263
XspI CTAG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.