MD01G1088800.v1.1

cyclin-B1-2-like

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
Physical Location & Seq
Forward (+)
20174089 .. 20174325
237 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1088800.v1.1.491

Sequence Viewer

Length: 237 bp
ATGGAGGCATCGAAGACGACGGAGCACCAAATCAGAGGAATCCAAAACGACGCCCTTCGGTTCAGACTTCACAGCGTCAAGAGCGACCTCGTTAGCGCTTACCTTCTCGAATCTGCTTTGGAATCCACAAAGTTAACCCAAGAGCAGATAAACACGAAAATCTTAGGGTACACTTATGGAAATGCGTTTCCACTGAAGATGGATTCCCTTCTCGATTCCAGAGGCCTTCCATACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

8.82

Weight (kDa)

6.72

Isoelectric Point (pI)

29.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
UMP1 PF05348 15 - 68 3.3e-08 Proteasome maturation factor UMP1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014438)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 215
AcyI GRCGYC 1 cut(s) 51
AfaI GTAC 1 cut(s) 170
AfeI AGCGCT 1 cut(s) 97
Alw21I GWGCWC 1 cut(s) 27
Aor51HI AGCGCT 1 cut(s) 97
AoxI GGCC 1 cut(s) 223
AspLEI GCGC 1 cut(s) 98
BbsI GAAGAC 1 cut(s) 20
Bbv12I GWGCWC 1 cut(s) 27
BccI CCATC 1 cut(s) 193
BfoI RGCGCY 1 cut(s) 99
BmsI GCATC 1 cut(s) 17
BpiI GAAGAC 1 cut(s) 20
BsaHI GRCGYC 1 cut(s) 51
BshFI GGCC 1 cut(s) 225
BsiHKAI GWGCWC 1 cut(s) 27
BsnI GGCC 1 cut(s) 225
Bsp1286I GDGCHC 1 cut(s) 27
BspANI GGCC 1 cut(s) 225
BssNI GRCGYC 1 cut(s) 51
BstACI GRCGYC 1 cut(s) 51
BstDEI CTNAG 1 cut(s) 163
BstH2I RGCGCY 1 cut(s) 99
BstHHI GCGC 1 cut(s) 98
BstMWI GCNNNNNNNGC 1 cut(s) 81
BstV2I GAAGAC 1 cut(s) 20
BsuRI GGCC 1 cut(s) 225
BtsIMutI CAGTG 1 cut(s) 191
CfoI GCGC 1 cut(s) 98
CseI GACGC 2 cut(s) 59, 64
Csp6I GTAC 1 cut(s) 169
CviJI RGCY 1 cut(s) 225
CviKI_1 RGCY 1 cut(s) 225
CviQI GTAC 1 cut(s) 169
DdeI CTNAG 1 cut(s) 163
Eco147I AGGCCT 1 cut(s) 225
Eco47III AGCGCT 1 cut(s) 97
Eco57I CTGAAG 1 cut(s) 215
FaiI YATR 2 cut(s) 177, 232
GlaI GCGC 1 cut(s) 97
HaeII RGCGCY 1 cut(s) 99
HaeIII GGCC 1 cut(s) 225
HgaI GACGC 2 cut(s) 59, 64
HhaI GCGC 1 cut(s) 98
Hin1I GRCGYC 1 cut(s) 51
Hin6I GCGC 1 cut(s) 96
HinP1I GCGC 1 cut(s) 96
HincII GTYRAC 1 cut(s) 135
HindII GTYRAC 1 cut(s) 135
HinfI GANTC 5 cut(s) 39, 110, 122, 203, 215
HpaI GTTAAC 1 cut(s) 135
Hpy166II GTNNAC 2 cut(s) 135, 171
Hpy188I TCNGA 2 cut(s) 35, 65
Hpy188III TCNNGA 4 cut(s) 79, 107, 212, 219
Hpy8I GTNNAC 2 cut(s) 135, 171
Hpy99I CGWCG 2 cut(s) 22, 53
HpyAV CCTTC 4 cut(s) 65, 113, 218, 236
HpyF10VI GCNNNNNNNGC 1 cut(s) 81
HpyF3I CTNAG 1 cut(s) 163
Hsp92I GRCGYC 1 cut(s) 51
HspAI GCGC 1 cut(s) 96
KspAI GTTAAC 1 cut(s) 135
LmnI GCTCC 1 cut(s) 22
LpnPI CCDG 1 cut(s) 232
LweI GCATC 1 cut(s) 17
MboII GAAGA 2 cut(s) 25, 208
MhlI GDGCHC 1 cut(s) 27
MnlI CCTC 3 cut(s) 29, 98, 215
MseI TTAA 1 cut(s) 134
MwoI GCNNNNNNNGC 1 cut(s) 81
PceI AGGCCT 1 cut(s) 225
PfeI GAWTC 5 cut(s) 39, 110, 122, 203, 215
RsaI GTAC 1 cut(s) 170
RsaNI GTAC 1 cut(s) 169
SaqAI TTAA 1 cut(s) 134
SduI GDGCHC 1 cut(s) 27
SetI ASST 2 cut(s) 90, 105
SfaNI GCATC 1 cut(s) 17
SgeI CNNG 7 cut(s) 91, 101, 119, 152, 166, 224, 231
SseBI AGGCCT 1 cut(s) 225
StuI AGGCCT 1 cut(s) 225
TaqI TCGA 3 cut(s) 11, 108, 213
TfiI GAWTC 5 cut(s) 39, 110, 122, 203, 215
Tru1I TTAA 1 cut(s) 134
Tru9I TTAA 1 cut(s) 134
TscAI CASTG 1 cut(s) 198
TspGWI ACGGA 1 cut(s) 35
TspRI CASTG 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.