Prupe.5G161800_v2.0.a1

cyclin-B1-2-like

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
Physical Location & Seq
Forward (+)
14203422 .. 14204684
1263 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G161800.1

Sequence Viewer

Length: 195 bp
ATGGATGTGTTAGATTTGCCCCTCTGCGCTAGCGCCCAAGGTTTGAAAGCGTTAAATAAGGGTTCTGGAAATCACCTCCTGGAGCTAATCATTTGGCAAGTTACACATACTAGCATAGTTCAAGGCGATGCGAGGTGCACGATGTGTTGTAGAGGTGTCTCTAATGGAGGCTGGGGCATCTCTAATGGAGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

6.67

Weight (kDa)

6.68

Isoelectric Point (pI)

9.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014438)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 144
AgsI TTSAA 2 cut(s) 46, 122
AjnI CCWGG 1 cut(s) 78
AluBI AGCT 1 cut(s) 85
AluI AGCT 1 cut(s) 85
Alw21I GWGCWC 1 cut(s) 140
Alw26I GTCTC 1 cut(s) 163
Alw44I GTGCAC 1 cut(s) 136
ApaLI GTGCAC 1 cut(s) 136
AspLEI GCGC 2 cut(s) 29, 35
AsuHPI GGTGA 1 cut(s) 65
AsuNHI GCTAGC 1 cut(s) 29
BaeGI GKGCMC 1 cut(s) 140
Bbv12I GWGCWC 1 cut(s) 140
BciT130I CCWGG 1 cut(s) 80
BcoDI GTCTC 1 cut(s) 163
BfaI CTAG 2 cut(s) 30, 111
BfoI RGCGCY 1 cut(s) 36
Bme1390I CCNGG 1 cut(s) 80
BmrFI CCNGG 1 cut(s) 80
BmsI GCATC 2 cut(s) 118, 186
BmtI GCTAGC 1 cut(s) 33
BpmI CTGGAG 1 cut(s) 101
BsaJI CCNNGG 1 cut(s) 37
BseBI CCWGG 1 cut(s) 80
BseDI CCNNGG 1 cut(s) 37
BseGI GGATG 1 cut(s) 10
BseSI GKGCMC 1 cut(s) 140
BseYI CCCAGC 1 cut(s) 171
BsiHKAI GWGCWC 1 cut(s) 140
BsmAI GTCTC 1 cut(s) 163
Bsp1286I GDGCHC 1 cut(s) 140
BspOI GCTAGC 1 cut(s) 33
BssECI CCNNGG 1 cut(s) 37
BssT1I CCWWGG 1 cut(s) 37
Bst2UI CCWGG 1 cut(s) 80
BstC8I GCNNGC 1 cut(s) 31
BstF5I GGATG 1 cut(s) 10
BstH2I RGCGCY 1 cut(s) 36
BstHHI GCGC 2 cut(s) 29, 35
BstMAI GTCTC 1 cut(s) 163
BstNI CCWGG 1 cut(s) 80
BstSCI CCNGG 1 cut(s) 78
BstSLI GKGCMC 1 cut(s) 140
BtgZI GCGATG 1 cut(s) 141
BtsCI GGATG 1 cut(s) 10
Cac8I GCNNGC 1 cut(s) 31
CfoI GCGC 2 cut(s) 29, 35
CviJI RGCY 3 cut(s) 85, 171, 192
CviKI_1 RGCY 3 cut(s) 85, 171, 192
DraIII CACNNNGTG 1 cut(s) 144
Eco130I CCWWGG 1 cut(s) 37
EcoRII CCWGG 1 cut(s) 78
EcoT14I CCWWGG 1 cut(s) 37
ErhI CCWWGG 1 cut(s) 37
FaiI YATR 2 cut(s) 108, 116
FokI GGATG 1 cut(s) 17
FspBI CTAG 2 cut(s) 30, 111
GlaI GCGC 2 cut(s) 28, 34
GsaI CCCAGC 1 cut(s) 175
GsuI CTGGAG 1 cut(s) 101
HaeII RGCGCY 1 cut(s) 36
HhaI GCGC 2 cut(s) 29, 35
Hin6I GCGC 2 cut(s) 27, 33
HinP1I GCGC 2 cut(s) 27, 33
HphI GGTGA 1 cut(s) 65
Hpy166II GTNNAC 1 cut(s) 138
Hpy188III TCNNGA 1 cut(s) 66
Hpy8I GTNNAC 1 cut(s) 138
HpyCH4V TGCA 1 cut(s) 138
HspAI GCGC 2 cut(s) 27, 33
LmnI GCTCC 1 cut(s) 82
LpnPI CCDG 4 cut(s) 51, 65, 92, 157
LweI GCATC 2 cut(s) 118, 186
MaeI CTAG 2 cut(s) 30, 111
MaeIII GTNAC 1 cut(s) 100
MhlI GDGCHC 1 cut(s) 140
MnlI CCTC 6 cut(s) 32, 86, 126, 146, 161, 182
MseI TTAA 1 cut(s) 53
MspR9I CCNGG 1 cut(s) 80
MvaI CCWGG 1 cut(s) 80
NheI GCTAGC 1 cut(s) 29
PfoI TCCNGGA 1 cut(s) 78
Psp6I CCWGG 1 cut(s) 78
PspFI CCCAGC 1 cut(s) 171
PspGI CCWGG 1 cut(s) 78
SaqAI TTAA 1 cut(s) 53
ScrFI CCNGG 1 cut(s) 80
SduI GDGCHC 1 cut(s) 140
SetI ASST 5 cut(s) 43, 78, 87, 137, 157
SfaNI GCATC 2 cut(s) 118, 186
SspMI CTAG 2 cut(s) 30, 111
StyD4I CCNGG 1 cut(s) 78
StyI CCWWGG 1 cut(s) 37
Tru1I TTAA 1 cut(s) 53
Tru9I TTAA 1 cut(s) 53
VneI GTGCAC 1 cut(s) 136
XspI CTAG 2 cut(s) 30, 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.