MD02G1004700.v1.1

CDK-activating kinase assembly factor MAT1

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
Physical Location & Seq
Forward (+)
323708 .. 328774
5067 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1004700.v1.1.491

Sequence Viewer

Length: 174 bp
ATGGGTCCACAACCACCACCACTTGGAGGAGGGGGGCATGATATGCACGGATACACTTTTGACGATATAGAAATGATGAAGGTGCGAGCAGAGAGAGGTGGTAGGGCAGGAGGGTGGAGCGGAGAGATGAGCAGGAAGAGGGCGGTAGGGCAGGGGGGTGGAGTGGAGAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.01

Weight (kDa)

8.29

Isoelectric Point (pI)

68.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 23
AccBSI CCGCTC 1 cut(s) 120
AciI CCGC 2 cut(s) 120, 143
AfiI CCNNNNNNNGG 2 cut(s) 23, 26
AspS9I GGNCC 1 cut(s) 5
AvaII GGWCC 1 cut(s) 5
BciVI GTATCC 1 cut(s) 44
BfuI GTATCC 1 cut(s) 44
Bme18I GGWCC 1 cut(s) 5
BmgT120I GGNCC 1 cut(s) 5
BmiI GGNNCC 1 cut(s) 6
Bsc4I CCNNNNNNNGG 2 cut(s) 23, 26
BseLI CCNNNNNNNGG 2 cut(s) 23, 26
BseRI GAGGAG 1 cut(s) 42
BslI CCNNNNNNNGG 2 cut(s) 23, 26
BspACI CCGC 2 cut(s) 120, 143
BspLI GGNNCC 1 cut(s) 6
BsrBI CCGCTC 1 cut(s) 120
Bst6I CTCTTC 1 cut(s) 131
BstAPI GCANNNNNTGC 1 cut(s) 43
BstC8I GCNNGC 1 cut(s) 87
BstMWI GCNNNNNNNGC 1 cut(s) 43
BsuI GTATCC 1 cut(s) 44
Cac8I GCNNGC 1 cut(s) 87
Cfr13I GGNCC 1 cut(s) 5
CviAII CATG 1 cut(s) 38
Eam1104I CTCTTC 1 cut(s) 131
EarI CTCTTC 1 cut(s) 131
Eco47I GGWCC 1 cut(s) 5
FaeI CATG 1 cut(s) 41
FaiI YATR 3 cut(s) 39, 44, 68
FatI CATG 1 cut(s) 37
Hin1II CATG 1 cut(s) 41
Hpy166II GTNNAC 1 cut(s) 8
Hpy8I GTNNAC 1 cut(s) 8
HpyAV CCTTC 1 cut(s) 73
HpyCH4V TGCA 1 cut(s) 46
HpyF10VI GCNNNNNNNGC 1 cut(s) 43
Hsp92II CATG 1 cut(s) 41
LmnI GCTCC 1 cut(s) 117
LpnPI CCDG 3 cut(s) 93, 118, 137
MbiI CCGCTC 1 cut(s) 120
MboII GAAGA 1 cut(s) 148
MnlI CCTC 5 cut(s) 20, 23, 89, 104, 132
MwoI GCNNNNNNNGC 1 cut(s) 43
NlaIII CATG 1 cut(s) 41
NlaIV GGNNCC 1 cut(s) 6
PflMI CCANNNNNTGG 1 cut(s) 23
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 5
Sau96I GGNCC 1 cut(s) 5
SetI ASST 2 cut(s) 84, 100
SgeI CNNG 7 cut(s) 35, 50, 59, 98, 120, 145, 164
SinI GGWCC 1 cut(s) 5
SsiI CCGC 2 cut(s) 120, 143
TspDTI ATGAA 1 cut(s) 92
TspGWI ACGGA 1 cut(s) 63
Van91I CCANNNNNTGG 1 cut(s) 23
VpaK11BI GGWCC 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.