MD02G1188700.v1.1

VQ motif

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
OG0008509
Physical Location & Seq
Forward (+)
17243932 .. 17244489
558 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1188700.v1.1.491

Sequence Viewer

Length: 558 bp
ATGGAATCCTATTCCTCTTCCTCCACAACCTCCTCCACCACCACATACTTGTCCCAAACCACGCAACCCACAAAGGATCCACTCCACTCTGTCCGAAAATCTTCGTCGAAGCCAAGGAAGAAGCCTGCAGTTGCACCACTTCCACCAACCCTACCAAGAGTCTACAAAGTCGACCCCATTAACTTCAGGGAGCTTGTCCACAGCCTCACCACCGCGCCAGAGTTTTTAGAGCCTCGGTCTCTCCAAAGCGTTGCGCCTCCGCCTATCGATACCAATATGTCCTCTCTACCAATTAATGTCCCTTCTTCTTCGCAGATCGAAAATGTGTCCTCTGCTCCAAACCATGTTTCTTCTTGTTGTTCTTCAGCTGCAACTGAAATCAGTTCACCATATTCCGTGATATACAAGGAACTGTCGGATACATTGGAGCTGAGTCCGATGCCTCGCCATGAGAAAGTGCAAGATAGCACGGTGGACTCGAGTTGTCTGAGACTGAATTTGCAGTCGCCGTCTTCCAATCATTGGGTTTCTTGGGAATCTGTCCACCCTGGAAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
VQ

Protein Analysis

186

Amino Acids

20.22

Weight (kDa)

7.01

Isoelectric Point (pI)

73.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 522
AccI GTMKAC 2 cut(s) 162, 171
AccII CGCG 1 cut(s) 215
AciI CCGC 2 cut(s) 213, 260
AclWI GGATC 2 cut(s) 71, 84
AcsI RAATTY 1 cut(s) 496
AcuI CTGAAG 2 cut(s) 169, 348
AfiI CCNNNNNNNGG 1 cut(s) 522
AjnI CCWGG 1 cut(s) 547
AjuI GAANNNNNNNTTGG 2 cut(s) 331, 363
AluBI AGCT 3 cut(s) 193, 368, 430
AluI AGCT 3 cut(s) 193, 368, 430
Alw26I GTCTC 2 cut(s) 243, 484
AlwI GGATC 2 cut(s) 71, 84
Ama87I CYCGRG 1 cut(s) 478
ApeKI GCWGC 1 cut(s) 368
ApoI RAATTY 1 cut(s) 496
AseI ATTAAT 1 cut(s) 294
Asp700I GAANNNNTTC 1 cut(s) 100
AspLEI GCGC 2 cut(s) 217, 256
AsuHPI GGTGA 2 cut(s) 199, 378
AvaI CYCGRG 1 cut(s) 478
BamHI GGATCC 1 cut(s) 76
BbsI GAAGAC 1 cut(s) 504
BbvI GCAGC 1 cut(s) 355
BceAI ACGGC 1 cut(s) 493
BciT130I CCWGG 1 cut(s) 549
BciVI GTATCC 1 cut(s) 412
BcoDI GTCTC 2 cut(s) 243, 484
BfmI CTRYAG 1 cut(s) 126
BfuI GTATCC 1 cut(s) 412
BisI GCNGC 1 cut(s) 369
BlsI GCNGC 1 cut(s) 370
Bme1390I CCNGG 1 cut(s) 549
BmeT110I CYCGRG 1 cut(s) 478
BmiI GGNNCC 1 cut(s) 78
BmrFI CCNGG 1 cut(s) 549
BmsI GCATC 1 cut(s) 429
BpiI GAAGAC 1 cut(s) 504
Bsa29I ATCGAT 1 cut(s) 267
BsaI GGTCTC 1 cut(s) 243
BsaJI CCNNGG 3 cut(s) 113, 233, 547
Bsc4I CCNNNNNNNGG 1 cut(s) 522
BseBI CCWGG 1 cut(s) 549
BseCI ATCGAT 1 cut(s) 267
BseDI CCNNGG 3 cut(s) 113, 233, 547
BseLI CCNNNNNNNGG 1 cut(s) 522
BseMII CTCAG 2 cut(s) 422, 479
BseRI GAGGAG 1 cut(s) 22
BseXI GCAGC 1 cut(s) 355
Bsh1236I CGCG 1 cut(s) 215
BshVI ATCGAT 1 cut(s) 267
BsiHKCI CYCGRG 1 cut(s) 478
BslFI GGGAC 2 cut(s) 37, 284
BslI CCNNNNNNNGG 1 cut(s) 522
BsmAI GTCTC 2 cut(s) 243, 484
BsmFI GGGAC 2 cut(s) 37, 284
Bso31I GGTCTC 1 cut(s) 243
BsoBI CYCGRG 1 cut(s) 478
Bsp143I GATC 2 cut(s) 76, 315
BspACI CCGC 2 cut(s) 213, 260
BspCNI CTCAG 2 cut(s) 423, 480
BspDI ATCGAT 1 cut(s) 267
BspFNI CGCG 1 cut(s) 215
BspLI GGNNCC 1 cut(s) 78
BspMAI CTGCAG 1 cut(s) 130
BspPI GGATC 2 cut(s) 71, 84
BspTNI GGTCTC 1 cut(s) 243
BssECI CCNNGG 3 cut(s) 113, 233, 547
BssMI GATC 2 cut(s) 76, 315
BssT1I CCWWGG 1 cut(s) 113
Bst2UI CCWGG 1 cut(s) 549
Bst4CI ACNGT 2 cut(s) 414, 472
Bst6I CTCTTC 1 cut(s) 22
BstC8I GCNNGC 1 cut(s) 126
BstDEI CTNAG 2 cut(s) 431, 488
BstFNI CGCG 1 cut(s) 215
BstHHI GCGC 2 cut(s) 217, 256
BstKTI GATC 2 cut(s) 79, 318
BstMAI GTCTC 2 cut(s) 243, 484
BstMBI GATC 2 cut(s) 76, 315
BstNI CCWGG 1 cut(s) 549
BstSCI CCNGG 1 cut(s) 547
BstSFI CTRYAG 1 cut(s) 126
BstUI CGCG 1 cut(s) 215
BstV1I GCAGC 1 cut(s) 355
BstV2I GAAGAC 1 cut(s) 504
BstX2I RGATCY 1 cut(s) 76
BstYI RGATCY 1 cut(s) 76
Bsu15I ATCGAT 1 cut(s) 267
BsuI GTATCC 1 cut(s) 412
BsuTUI ATCGAT 1 cut(s) 267
Cac8I GCNNGC 1 cut(s) 126
CfoI GCGC 2 cut(s) 217, 256
ClaI ATCGAT 1 cut(s) 267
CviAII CATG 2 cut(s) 344, 449
CviJI RGCY 7 cut(s) 112, 124, 193, 204, 232, 368, 430
CviKI_1 RGCY 7 cut(s) 112, 124, 193, 204, 232, 368, 430
DdeI CTNAG 2 cut(s) 431, 488
DpnI GATC 2 cut(s) 78, 317
DpnII GATC 2 cut(s) 76, 315
Eam1104I CTCTTC 1 cut(s) 22
EarI CTCTTC 1 cut(s) 22
EciI GGCGGA 1 cut(s) 249
Eco130I CCWWGG 1 cut(s) 113
Eco31I GGTCTC 1 cut(s) 243
Eco57I CTGAAG 2 cut(s) 169, 348
Eco88I CYCGRG 1 cut(s) 478
EcoRII CCWGG 1 cut(s) 547
EcoT14I CCWWGG 1 cut(s) 113
ErhI CCWWGG 1 cut(s) 113
FaeI CATG 2 cut(s) 347, 452
FaiI YATR 6 cut(s) 46, 278, 345, 391, 403, 450
FaqI GGGAC 2 cut(s) 37, 284
FatI CATG 2 cut(s) 343, 448
FblI GTMKAC 2 cut(s) 162, 171
Fnu4HI GCNGC 1 cut(s) 369
Fsp4HI GCNGC 1 cut(s) 369
GlaI GCGC 2 cut(s) 216, 255
GluI GCNGC 1 cut(s) 369
HhaI GCGC 2 cut(s) 217, 256
Hin1II CATG 2 cut(s) 347, 452
Hin6I GCGC 2 cut(s) 215, 254
HinP1I GCGC 2 cut(s) 215, 254
HincII GTYRAC 1 cut(s) 172
HindII GTYRAC 1 cut(s) 172
HinfI GANTC 5 cut(s) 5, 159, 433, 476, 536
HphI GGTGA 2 cut(s) 199, 378
Hpy166II GTNNAC 6 cut(s) 163, 172, 199, 386, 475, 544
Hpy188I TCNGA 4 cut(s) 95, 418, 438, 489
Hpy8I GTNNAC 6 cut(s) 163, 172, 199, 386, 475, 544
Hpy99I CGWCG 1 cut(s) 109
HpyAV CCTTC 1 cut(s) 312
HpyCH4III ACNGT 2 cut(s) 414, 472
HpyCH4V TGCA 5 cut(s) 128, 134, 371, 460, 502
HpyF3I CTNAG 2 cut(s) 431, 488
Hsp92II CATG 2 cut(s) 347, 452
HspAI GCGC 2 cut(s) 215, 254
Kzo9I GATC 2 cut(s) 76, 315
LmnI GCTCC 3 cut(s) 190, 340, 427
LpnPI CCDG 4 cut(s) 138, 172, 231, 534
Lsp1109I GCAGC 1 cut(s) 355
LweI GCATC 1 cut(s) 429
MalI GATC 2 cut(s) 78, 317
MboI GATC 2 cut(s) 76, 315
MboII GAAGA 8 cut(s) 9, 93, 130, 297, 300, 342, 354, 504
MflI RGATCY 1 cut(s) 76
MluCI AATT 2 cut(s) 291, 496
MlyI GAGTC 3 cut(s) 168, 442, 470
MmeI TCCRAC 1 cut(s) 396
MroXI GAANNNNTTC 1 cut(s) 100
MseI TTAA 2 cut(s) 180, 294
MspA1I CMGCKG 1 cut(s) 368
MspR9I CCNGG 1 cut(s) 549
MvaI CCWGG 1 cut(s) 549
MvnI CGCG 1 cut(s) 215
NdeII GATC 2 cut(s) 76, 315
NlaIII CATG 2 cut(s) 347, 452
NlaIV GGNNCC 1 cut(s) 78
PaeR7I CTCGAG 1 cut(s) 478
PcsI WCGNNNNNNNCGW 1 cut(s) 476
PdmI GAANNNNTTC 1 cut(s) 100
PfeI GAWTC 2 cut(s) 5, 536
PflMI CCANNNNNTGG 1 cut(s) 522
PkrI GCNGC 1 cut(s) 370
PleI GAGTC 3 cut(s) 167, 441, 470
PpsI GAGTC 3 cut(s) 167, 441, 470
PshBI ATTAAT 1 cut(s) 294
Psp6I CCWGG 1 cut(s) 547
PspGI CCWGG 1 cut(s) 547
PspN4I GGNNCC 1 cut(s) 78
PspXI VCTCGAGB 1 cut(s) 478
PstI CTGCAG 1 cut(s) 130
PsuI RGATCY 1 cut(s) 76
PvuII CAGCTG 1 cut(s) 368
SalI GTCGAC 1 cut(s) 170
SaqAI TTAA 2 cut(s) 180, 294
SatI GCNGC 1 cut(s) 369
Sau3AI GATC 2 cut(s) 76, 315
SchI GAGTC 3 cut(s) 168, 442, 470
ScrFI CCNGG 1 cut(s) 549
SetI ASST 4 cut(s) 32, 195, 370, 432
SfaNI GCATC 1 cut(s) 429
SfcI CTRYAG 1 cut(s) 126
Sfr274I CTCGAG 1 cut(s) 478
SlaI CTCGAG 1 cut(s) 478
SmlI CTYRAG 1 cut(s) 478
SmoI CTYRAG 1 cut(s) 478
Sse9I AATT 2 cut(s) 291, 496
SsiI CCGC 2 cut(s) 213, 260
StyD4I CCNGG 1 cut(s) 547
StyI CCWWGG 1 cut(s) 113
TaaI ACNGT 2 cut(s) 414, 472
TaqI TCGA 5 cut(s) 107, 171, 267, 318, 479
TaqII GACCGA 1 cut(s) 225
TasI AATT 2 cut(s) 291, 496
TfiI GAWTC 2 cut(s) 5, 536
Tru1I TTAA 2 cut(s) 180, 294
Tru9I TTAA 2 cut(s) 180, 294
TseI GCWGC 1 cut(s) 368
TspGWI ACGGA 1 cut(s) 385
Van91I CCANNNNNTGG 1 cut(s) 522
VspI ATTAAT 1 cut(s) 294
XapI RAATTY 1 cut(s) 496
XhoI CTCGAG 1 cut(s) 478
XmiI GTMKAC 2 cut(s) 162, 171
XmnI GAANNNNTTC 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.