MD02G1202800.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
OG0010368
Physical Location & Seq
Forward (+)
20118776 .. 20119105
330 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1202800.v1.1.491

Sequence Viewer

Length: 330 bp
ATGATGAGCAGCAGGGAGAGTAGAGAAAATGATGAAGAAGATGGGAAAGGTTTGTCGTGGAAGCTTCCAATCCTTGGAACCCAGGGTCTCGCCTTTGGCCTCGGCGCTAGCTGTGGCTTGGGTTTCGGCATCTGCTTCCTCGGCGACGCAGGATTTGGTCCTGGGATTCCTGGCTTGCAAGTTGGCTTGGGCCTTGGTGCTGGATGCGGGGTTGGCTTAGGATTCAGCTACGATGTCGAAAAGGGCATTGCCTACAATGATAATCGCAGATACTCTAATGTAGGCAACCTTTTTCCTGGTGAAAATGTCGGCATTTCTCCTGCTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

110

Amino Acids

11.09

Weight (kDa)

4.54

Isoelectric Point (pI)

34.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 74
AciI CCGC 1 cut(s) 207
AfiI CCNNNNNNNGG 1 cut(s) 74
AjnI CCWGG 4 cut(s) 81, 160, 169, 295
AluBI AGCT 3 cut(s) 64, 111, 228
AluI AGCT 3 cut(s) 64, 111, 228
Alw26I GTCTC 1 cut(s) 92
AoxI GGCC 2 cut(s) 97, 190
ApeKI GCWGC 1 cut(s) 9
ArsI GACNNNNNNTTYG 2 cut(s) 137, 169
AspLEI GCGC 1 cut(s) 107
AspS9I GGNCC 2 cut(s) 158, 190
AsuHPI GGTGA 1 cut(s) 311
AsuNHI GCTAGC 1 cut(s) 107
AvaII GGWCC 1 cut(s) 158
BbvI GCAGC 1 cut(s) 21
BccI CCATC 1 cut(s) 35
BciT130I CCWGG 4 cut(s) 83, 162, 171, 297
BcoDI GTCTC 1 cut(s) 92
BfaI CTAG 1 cut(s) 108
BfoI RGCGCY 1 cut(s) 108
BisI GCNGC 1 cut(s) 10
BlsI GCNGC 1 cut(s) 11
Bme1390I CCNGG 4 cut(s) 83, 162, 171, 297
Bme18I GGWCC 1 cut(s) 158
BmgT120I GGNCC 2 cut(s) 158, 190
BmiI GGNNCC 1 cut(s) 79
BmrFI CCNGG 4 cut(s) 83, 162, 171, 297
BmsI GCATC 2 cut(s) 138, 194
BmtI GCTAGC 1 cut(s) 111
Bpu10I CCTNAGC 1 cut(s) 217
BsaI GGTCTC 1 cut(s) 92
BsaJI CCNNGG 7 cut(s) 73, 81, 82, 100, 139, 161, 193
Bsc4I CCNNNNNNNGG 1 cut(s) 74
Bse3DI GCAATG 1 cut(s) 246
BseBI CCWGG 4 cut(s) 83, 162, 171, 297
BseDI CCNNGG 7 cut(s) 73, 81, 82, 100, 139, 161, 193
BseGI GGATG 1 cut(s) 209
BseLI CCNNNNNNNGG 1 cut(s) 74
BseMI GCAATG 1 cut(s) 246
BseXI GCAGC 1 cut(s) 21
BshFI GGCC 2 cut(s) 99, 192
BslI CCNNNNNNNGG 1 cut(s) 74
BsmAI GTCTC 1 cut(s) 92
BsnI GGCC 2 cut(s) 99, 192
Bso31I GGTCTC 1 cut(s) 92
BspACI CCGC 1 cut(s) 207
BspANI GGCC 2 cut(s) 99, 192
BspLI GGNNCC 1 cut(s) 79
BspOI GCTAGC 1 cut(s) 111
BspTNI GGTCTC 1 cut(s) 92
BsrDI GCAATG 1 cut(s) 246
BssECI CCNNGG 7 cut(s) 73, 81, 82, 100, 139, 161, 193
BssT1I CCWWGG 2 cut(s) 73, 193
Bst2UI CCWGG 4 cut(s) 83, 162, 171, 297
BstC8I GCNNGC 2 cut(s) 109, 176
BstDEI CTNAG 1 cut(s) 217
BstF5I GGATG 1 cut(s) 209
BstH2I RGCGCY 1 cut(s) 108
BstHHI GCGC 1 cut(s) 107
BstMAI GTCTC 1 cut(s) 92
BstMWI GCNNNNNNNGC 2 cut(s) 141, 213
BstNI CCWGG 4 cut(s) 83, 162, 171, 297
BstSCI CCNGG 4 cut(s) 81, 160, 169, 295
BstV1I GCAGC 1 cut(s) 21
BsuRI GGCC 2 cut(s) 99, 192
BtsCI GGATG 1 cut(s) 209
Cac8I GCNNGC 2 cut(s) 109, 176
CfoI GCGC 1 cut(s) 107
Cfr13I GGNCC 2 cut(s) 158, 190
CseI GACGC 1 cut(s) 155
CviJI RGCY 9 cut(s) 64, 99, 111, 117, 174, 186, 192, 216, 228
CviKI_1 RGCY 9 cut(s) 64, 99, 111, 117, 174, 186, 192, 216, 228
DdeI CTNAG 1 cut(s) 217
Eco130I CCWWGG 2 cut(s) 73, 193
Eco31I GGTCTC 1 cut(s) 92
Eco47I GGWCC 1 cut(s) 158
EcoRII CCWGG 4 cut(s) 81, 160, 169, 295
EcoT14I CCWWGG 2 cut(s) 73, 193
ErhI CCWWGG 2 cut(s) 73, 193
FauI CCCGC 1 cut(s) 200
Fnu4HI GCNGC 1 cut(s) 10
FokI GGATG 1 cut(s) 216
Fsp4HI GCNGC 1 cut(s) 10
FspBI CTAG 1 cut(s) 108
GlaI GCGC 1 cut(s) 106
GluI GCNGC 1 cut(s) 10
HaeII RGCGCY 1 cut(s) 108
HaeIII GGCC 2 cut(s) 99, 192
HgaI GACGC 1 cut(s) 155
HhaI GCGC 1 cut(s) 107
Hin6I GCGC 1 cut(s) 105
HinP1I GCGC 1 cut(s) 105
HindIII AAGCTT 1 cut(s) 62
HinfI GANTC 2 cut(s) 166, 222
HphI GGTGA 1 cut(s) 311
Hpy188III TCNNGA 1 cut(s) 327
Hpy99I CGWCG 1 cut(s) 149
HpyCH4V TGCA 1 cut(s) 178
HpyF10VI GCNNNNNNNGC 2 cut(s) 141, 213
HpyF3I CTNAG 1 cut(s) 217
HspAI GCGC 1 cut(s) 105
Lsp1109I GCAGC 1 cut(s) 21
LweI GCATC 2 cut(s) 138, 194
MaeI CTAG 1 cut(s) 108
MboII GAAGA 2 cut(s) 47, 50
MnlI CCTC 2 cut(s) 110, 149
MspR9I CCNGG 4 cut(s) 83, 162, 171, 297
MvaI CCWGG 4 cut(s) 83, 162, 171, 297
MwoI GCNNNNNNNGC 2 cut(s) 141, 213
NheI GCTAGC 1 cut(s) 107
NlaIV GGNNCC 1 cut(s) 79
NmeAIII GCCGAG 2 cut(s) 81, 120
PasI CCCWGGG 1 cut(s) 82
PfeI GAWTC 2 cut(s) 166, 222
PflMI CCANNNNNTGG 1 cut(s) 74
PkrI GCNGC 1 cut(s) 11
Psp6I CCWGG 4 cut(s) 81, 160, 169, 295
PspGI CCWGG 4 cut(s) 81, 160, 169, 295
PspN4I GGNNCC 1 cut(s) 79
PspPI GGNCC 2 cut(s) 158, 190
SatI GCNGC 1 cut(s) 10
Sau96I GGNCC 2 cut(s) 158, 190
ScrFI CCNGG 4 cut(s) 83, 162, 171, 297
SetI ASST 5 cut(s) 52, 66, 113, 230, 291
SfaNI GCATC 2 cut(s) 138, 194
SinI GGWCC 1 cut(s) 158
SsiI CCGC 1 cut(s) 207
SspMI CTAG 1 cut(s) 108
StyD4I CCNGG 4 cut(s) 81, 160, 169, 295
StyI CCWWGG 2 cut(s) 73, 193
TaqI TCGA 1 cut(s) 237
TfiI GAWTC 2 cut(s) 166, 222
TseI GCWGC 1 cut(s) 9
TspDTI ATGAA 1 cut(s) 48
Van91I CCANNNNNTGG 1 cut(s) 74
VpaK11BI GGWCC 1 cut(s) 158
XspI CTAG 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.