pycom215g00060

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00000215
OG0010368
Physical Location & Seq
Reverse (-)
182014 .. 183411
1398 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom215g00060.2

Sequence Viewer

Length: 438 bp
ATGATGGGCAGCAGGGGGAGTAGAGAAGATGATGGAGGAGCGGGGAAGGGTTTGTTGTGGAAGCTTCCAATCCTCAGAACCCAGCAACTAGGGAAGGTGGGTCCCGCCTTTGGCCTCGGCGCTGGCTGCGGCTTAGGTTTCGGCATCGGCCTCCTCGGCGGCGCAGGATTTGGTCCTGGGATTCCTGGCTTGCAAGTTGGCTTTGGCCTTGGTGCTGGATGCGGGGTCGGCTTAGGATTCGGCTACGGTGTCGGAAGGGGCATTGCCTACGATGACAATCGCAGATACTCTAATGTAGGCAACCTTTTTCGTGGTGAAAATGTCGGCATTTCTCCTGCTACTCAGGATGATATTGGTGCACTTGTTGAGGAGCTTGTTGATAATACGAAGAAACTTGTCAGAGCTACTACAAGAGAGATGGACAAGTGGAGAAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

146

Amino Acids

14.91

Weight (kDa)

9.34

Isoelectric Point (pI)

22.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 41
AciI CCGC 5 cut(s) 41, 105, 129, 159, 222
AfiI CCNNNNNNNGG 1 cut(s) 110
AjnI CCWGG 2 cut(s) 175, 184
AluBI AGCT 3 cut(s) 64, 373, 404
AluI AGCT 3 cut(s) 64, 373, 404
Alw21I GWGCWC 1 cut(s) 361
Alw44I GTGCAC 1 cut(s) 357
AoxI GGCC 3 cut(s) 112, 148, 205
ApaLI GTGCAC 1 cut(s) 357
ApeKI GCWGC 2 cut(s) 9, 126
AspLEI GCGC 2 cut(s) 122, 164
AspS9I GGNCC 2 cut(s) 101, 173
AsuHPI GGTGA 1 cut(s) 326
AvaII GGWCC 2 cut(s) 101, 173
BaeGI GKGCMC 1 cut(s) 361
Bbv12I GWGCWC 1 cut(s) 361
BbvI GCAGC 2 cut(s) 21, 113
BccI CCATC 2 cut(s) 26, 412
BciT130I CCWGG 2 cut(s) 177, 186
BfaI CTAG 1 cut(s) 89
BfoI RGCGCY 1 cut(s) 123
BglI GCCNNNNNGGC 1 cut(s) 156
BisI GCNGC 4 cut(s) 10, 127, 130, 160
BlsI GCNGC 4 cut(s) 11, 128, 131, 161
Bme1390I CCNGG 2 cut(s) 177, 186
Bme18I GGWCC 2 cut(s) 101, 173
BmgT120I GGNCC 2 cut(s) 101, 173
BmiI GGNNCC 2 cut(s) 102, 103
BmrFI CCNGG 2 cut(s) 177, 186
BmsI GCATC 2 cut(s) 153, 209
Bpu10I CCTNAGC 2 cut(s) 133, 232
BsaBI GATNNNNATC 1 cut(s) 276
BsaJI CCNNGG 4 cut(s) 115, 154, 176, 208
Bsc4I CCNNNNNNNGG 1 cut(s) 110
Bse3DI GCAATG 1 cut(s) 261
Bse8I GATNNNNATC 1 cut(s) 276
BseBI CCWGG 2 cut(s) 177, 186
BseDI CCNNGG 4 cut(s) 115, 154, 176, 208
BseGI GGATG 2 cut(s) 224, 352
BseJI GATNNNNATC 1 cut(s) 276
BseLI CCNNNNNNNGG 1 cut(s) 110
BseMI GCAATG 1 cut(s) 261
BseMII CTCAG 2 cut(s) 88, 356
BseRI GAGGAG 3 cut(s) 51, 143, 383
BseSI GKGCMC 1 cut(s) 361
BseXI GCAGC 2 cut(s) 21, 113
BseYI CCCAGC 1 cut(s) 81
BshFI GGCC 3 cut(s) 114, 150, 207
BsiHKAI GWGCWC 1 cut(s) 361
BslFI GGGAC 1 cut(s) 87
BslI CCNNNNNNNGG 1 cut(s) 110
BsmFI GGGAC 1 cut(s) 87
BsnI GGCC 3 cut(s) 114, 150, 207
Bsp1286I GDGCHC 1 cut(s) 361
BspACI CCGC 5 cut(s) 41, 105, 129, 159, 222
BspANI GGCC 3 cut(s) 114, 150, 207
BspCNI CTCAG 2 cut(s) 87, 355
BspLI GGNNCC 2 cut(s) 102, 103
BsrBI CCGCTC 1 cut(s) 41
BsrDI GCAATG 1 cut(s) 261
BssECI CCNNGG 4 cut(s) 115, 154, 176, 208
BssT1I CCWWGG 1 cut(s) 208
Bst2UI CCWGG 2 cut(s) 177, 186
Bst4CI ACNGT 1 cut(s) 248
BstC8I GCNNGC 2 cut(s) 124, 191
BstDEI CTNAG 4 cut(s) 74, 133, 232, 342
BstF5I GGATG 2 cut(s) 224, 352
BstH2I RGCGCY 1 cut(s) 123
BstHHI GCGC 2 cut(s) 122, 164
BstMWI GCNNNNNNNGC 3 cut(s) 126, 156, 228
BstNI CCWGG 2 cut(s) 177, 186
BstSCI CCNGG 2 cut(s) 175, 184
BstSLI GKGCMC 1 cut(s) 361
BstV1I GCAGC 2 cut(s) 21, 113
BsuRI GGCC 3 cut(s) 114, 150, 207
BtsCI GGATG 2 cut(s) 224, 352
Cac8I GCNNGC 2 cut(s) 124, 191
CfoI GCGC 2 cut(s) 122, 164
Cfr13I GGNCC 2 cut(s) 101, 173
DdeI CTNAG 4 cut(s) 74, 133, 232, 342
Eco130I CCWWGG 1 cut(s) 208
Eco47I GGWCC 2 cut(s) 101, 173
EcoO109I RGGNCCY 1 cut(s) 101
EcoRII CCWGG 2 cut(s) 175, 184
EcoT14I CCWWGG 1 cut(s) 208
ErhI CCWWGG 1 cut(s) 208
FaqI GGGAC 1 cut(s) 87
FauI CCCGC 3 cut(s) 34, 112, 215
Fnu4HI GCNGC 4 cut(s) 10, 127, 130, 160
FokI GGATG 2 cut(s) 231, 359
Fsp4HI GCNGC 4 cut(s) 10, 127, 130, 160
FspBI CTAG 1 cut(s) 89
GlaI GCGC 2 cut(s) 121, 163
GluI GCNGC 4 cut(s) 10, 127, 130, 160
GsaI CCCAGC 1 cut(s) 85
HaeII RGCGCY 1 cut(s) 123
HaeIII GGCC 3 cut(s) 114, 150, 207
HhaI GCGC 2 cut(s) 122, 164
Hin6I GCGC 2 cut(s) 120, 162
HinP1I GCGC 2 cut(s) 120, 162
HindIII AAGCTT 1 cut(s) 62
HinfI GANTC 2 cut(s) 181, 237
HphI GGTGA 1 cut(s) 326
Hpy166II GTNNAC 1 cut(s) 359
Hpy188I TCNGA 3 cut(s) 77, 254, 401
Hpy188III TCNNGA 1 cut(s) 344
Hpy8I GTNNAC 1 cut(s) 359
HpyAV CCTTC 3 cut(s) 40, 88, 249
HpyCH4III ACNGT 1 cut(s) 248
HpyCH4V TGCA 2 cut(s) 193, 359
HpyF10VI GCNNNNNNNGC 3 cut(s) 126, 156, 228
HpyF3I CTNAG 4 cut(s) 74, 133, 232, 342
HspAI GCGC 2 cut(s) 120, 162
KflI GGGWCCC 1 cut(s) 101
LmnI GCTCC 2 cut(s) 38, 370
Lsp1109I GCAGC 2 cut(s) 21, 113
LweI GCATC 2 cut(s) 153, 209
MaeI CTAG 1 cut(s) 89
MbiI CCGCTC 1 cut(s) 41
MboII GAAGA 2 cut(s) 38, 400
MhlI GDGCHC 1 cut(s) 361
MmeI TCCRAC 1 cut(s) 232
MnlI CCTC 6 cut(s) 29, 83, 125, 161, 164, 361
MspR9I CCNGG 2 cut(s) 177, 186
MvaI CCWGG 2 cut(s) 177, 186
MwoI GCNNNNNNNGC 3 cut(s) 126, 156, 228
NlaIV GGNNCC 2 cut(s) 102, 103
NmeAIII GCCGAG 2 cut(s) 96, 135
PfeI GAWTC 2 cut(s) 181, 237
PkrI GCNGC 4 cut(s) 11, 128, 131, 161
PpuMI RGGWCCY 1 cut(s) 101
Psp5II RGGWCCY 1 cut(s) 101
Psp6I CCWGG 2 cut(s) 175, 184
PspFI CCCAGC 1 cut(s) 81
PspGI CCWGG 2 cut(s) 175, 184
PspN4I GGNNCC 2 cut(s) 102, 103
PspPI GGNCC 2 cut(s) 101, 173
PspPPI RGGWCCY 1 cut(s) 101
SatI GCNGC 4 cut(s) 10, 127, 130, 160
Sau96I GGNCC 2 cut(s) 101, 173
ScrFI CCNGG 2 cut(s) 177, 186
SduI GDGCHC 1 cut(s) 361
SetI ASST 6 cut(s) 66, 99, 139, 306, 375, 406
SfaNI GCATC 2 cut(s) 153, 209
SinI GGWCC 2 cut(s) 101, 173
SsiI CCGC 5 cut(s) 41, 105, 129, 159, 222
SspMI CTAG 1 cut(s) 89
StyD4I CCNGG 2 cut(s) 175, 184
StyI CCWWGG 1 cut(s) 208
TaaI ACNGT 1 cut(s) 248
TauI GCSGC 2 cut(s) 132, 162
TfiI GAWTC 2 cut(s) 181, 237
TseI GCWGC 2 cut(s) 9, 126
VneI GTGCAC 1 cut(s) 357
VpaK11BI GGWCC 2 cut(s) 101, 173
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.