pycom10g00020

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
OG0010368
Physical Location & Seq
Forward (+)
12246 .. 13630
1385 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g00020.3

Sequence Viewer

Length: 453 bp
ATGATGGGCAGCAGGGGGAGCAGAGAAGATGATGGAGGAGAAGGGAAGGGTTGGTTGTGGAAGCTTCCAGTCCTCAAATCCCAGCGACTAGGGAAGGTGGGCCCCGCATTTGGCCTCGGCGTTGGCTGCGGCGTGGGCTTCGGCATCGGCCTACTCGGCGGCGCAGGATTTGGTCCTGGGATTCCTGGCTTGCAAGTTGGCTTTGGCCTTGGTGCTGGATGCGGGGTCGGCTTAGGATTTGGCTACGGTGTCGGAAAGGGCATTGCCTACGATGACCATCGCAGGTACTCTAATGCTGGCAACCTTTTTCGTGATGGAAATGTCGGCATTTCTTGCGCTTCTCGAAATCTTCCTACTCAGGATGATATTGGTGCACTTGTTGAGGAGCTTGTTGATAATACGAAGAAACTTGTCAAAGCTACTGCAAGAGAGATGGACAAATGGAGAAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

151

Amino Acids

15.5

Weight (kDa)

9.3

Isoelectric Point (pI)

23.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 273
AciI CCGC 4 cut(s) 105, 129, 159, 222
AfaI GTAC 1 cut(s) 287
AfiI CCNNNNNNNGG 1 cut(s) 110
AjnI CCWGG 2 cut(s) 175, 184
AluBI AGCT 3 cut(s) 64, 388, 419
AluI AGCT 3 cut(s) 64, 388, 419
Alw21I GWGCWC 1 cut(s) 376
Alw44I GTGCAC 1 cut(s) 372
AoxI GGCC 4 cut(s) 100, 112, 148, 205
ApaI GGGCCC 1 cut(s) 104
ApaLI GTGCAC 1 cut(s) 372
ApeKI GCWGC 2 cut(s) 9, 126
AspLEI GCGC 2 cut(s) 164, 338
AspS9I GGNCC 3 cut(s) 100, 101, 173
AvaII GGWCC 1 cut(s) 173
BaeGI GKGCMC 2 cut(s) 104, 376
BanII GRGCYC 1 cut(s) 104
Bbv12I GWGCWC 1 cut(s) 376
BbvI GCAGC 2 cut(s) 21, 113
BccI CCATC 4 cut(s) 26, 285, 308, 427
BciT130I CCWGG 2 cut(s) 177, 186
BfaI CTAG 1 cut(s) 89
BfuAI ACCTGC 1 cut(s) 273
BglI GCCNNNNNGGC 1 cut(s) 156
BisI GCNGC 4 cut(s) 10, 127, 130, 160
BlsI GCNGC 4 cut(s) 11, 128, 131, 161
Bme1390I CCNGG 2 cut(s) 177, 186
Bme18I GGWCC 1 cut(s) 173
BmgT120I GGNCC 3 cut(s) 100, 101, 173
BmiI GGNNCC 2 cut(s) 102, 103
BmrFI CCNGG 2 cut(s) 177, 186
BmsI GCATC 2 cut(s) 153, 209
Bpu10I CCTNAGC 1 cut(s) 232
BsaBI GATNNNNATC 1 cut(s) 276
BsaJI CCNNGG 3 cut(s) 115, 176, 208
Bsc4I CCNNNNNNNGG 1 cut(s) 110
Bse1I ACTGG 1 cut(s) 68
Bse3DI GCAATG 1 cut(s) 261
Bse8I GATNNNNATC 1 cut(s) 276
BseBI CCWGG 2 cut(s) 177, 186
BseDI CCNNGG 3 cut(s) 115, 176, 208
BseGI GGATG 2 cut(s) 224, 367
BseJI GATNNNNATC 1 cut(s) 276
BseLI CCNNNNNNNGG 1 cut(s) 110
BseMI GCAATG 1 cut(s) 261
BseMII CTCAG 1 cut(s) 371
BseNI ACTGG 1 cut(s) 68
BseRI GAGGAG 2 cut(s) 51, 398
BseSI GKGCMC 2 cut(s) 104, 376
BseXI GCAGC 2 cut(s) 21, 113
BseYI CCCAGC 1 cut(s) 81
BshFI GGCC 4 cut(s) 102, 114, 150, 207
BsiHKAI GWGCWC 1 cut(s) 376
BslI CCNNNNNNNGG 1 cut(s) 110
BsnI GGCC 4 cut(s) 102, 114, 150, 207
Bsp120I GGGCCC 1 cut(s) 100
Bsp1286I GDGCHC 2 cut(s) 104, 376
BspACI CCGC 4 cut(s) 105, 129, 159, 222
BspANI GGCC 4 cut(s) 102, 114, 150, 207
BspCNI CTCAG 1 cut(s) 370
BspLI GGNNCC 2 cut(s) 102, 103
BspMI ACCTGC 1 cut(s) 273
BsrDI GCAATG 1 cut(s) 261
BsrI ACTGG 1 cut(s) 68
BssECI CCNNGG 3 cut(s) 115, 176, 208
BssT1I CCWWGG 1 cut(s) 208
Bst2UI CCWGG 2 cut(s) 177, 186
Bst4CI ACNGT 1 cut(s) 248
BstAPI GCANNNNNTGC 1 cut(s) 333
BstC8I GCNNGC 2 cut(s) 191, 298
BstDEI CTNAG 2 cut(s) 232, 357
BstF5I GGATG 2 cut(s) 224, 367
BstHHI GCGC 2 cut(s) 164, 338
BstMWI GCNNNNNNNGC 6 cut(s) 18, 126, 135, 156, 228, 333
BstNI CCWGG 2 cut(s) 177, 186
BstSCI CCNGG 2 cut(s) 175, 184
BstSLI GKGCMC 2 cut(s) 104, 376
BstV1I GCAGC 2 cut(s) 21, 113
BsuRI GGCC 4 cut(s) 102, 114, 150, 207
BtgZI GCGATG 1 cut(s) 263
BtsCI GGATG 2 cut(s) 224, 367
BveI ACCTGC 1 cut(s) 273
Cac8I GCNNGC 2 cut(s) 191, 298
CfoI GCGC 2 cut(s) 164, 338
Cfr13I GGNCC 3 cut(s) 100, 101, 173
Csp6I GTAC 1 cut(s) 286
CviQI GTAC 1 cut(s) 286
DdeI CTNAG 2 cut(s) 232, 357
Eco130I CCWWGG 1 cut(s) 208
Eco24I GRGCYC 1 cut(s) 104
Eco47I GGWCC 1 cut(s) 173
EcoO109I RGGNCCY 1 cut(s) 101
EcoRII CCWGG 2 cut(s) 175, 184
EcoT14I CCWWGG 1 cut(s) 208
EcoT38I GRGCYC 1 cut(s) 104
ErhI CCWWGG 1 cut(s) 208
FauI CCCGC 2 cut(s) 112, 215
Fnu4HI GCNGC 4 cut(s) 10, 127, 130, 160
FokI GGATG 2 cut(s) 231, 374
FriOI GRGCYC 1 cut(s) 104
Fsp4HI GCNGC 4 cut(s) 10, 127, 130, 160
FspBI CTAG 1 cut(s) 89
GlaI GCGC 2 cut(s) 163, 337
GluI GCNGC 4 cut(s) 10, 127, 130, 160
GsaI CCCAGC 1 cut(s) 85
HaeIII GGCC 4 cut(s) 102, 114, 150, 207
HhaI GCGC 2 cut(s) 164, 338
Hin6I GCGC 2 cut(s) 162, 336
HinP1I GCGC 2 cut(s) 162, 336
HindIII AAGCTT 1 cut(s) 62
HinfI GANTC 1 cut(s) 181
Hpy166II GTNNAC 1 cut(s) 374
Hpy188I TCNGA 1 cut(s) 254
Hpy188III TCNNGA 3 cut(s) 311, 342, 359
Hpy8I GTNNAC 1 cut(s) 374
HpyAV CCTTC 3 cut(s) 35, 40, 88
HpyCH4III ACNGT 1 cut(s) 248
HpyCH4V TGCA 3 cut(s) 193, 374, 425
HpyF10VI GCNNNNNNNGC 6 cut(s) 18, 126, 135, 156, 228, 333
HpyF3I CTNAG 2 cut(s) 232, 357
HspAI GCGC 2 cut(s) 162, 336
LmnI GCTCC 2 cut(s) 18, 385
Lsp1109I GCAGC 2 cut(s) 21, 113
LweI GCATC 2 cut(s) 153, 209
MaeI CTAG 1 cut(s) 89
MboII GAAGA 3 cut(s) 38, 341, 415
MhlI GDGCHC 2 cut(s) 104, 376
MmeI TCCRAC 1 cut(s) 232
MnlI CCTC 4 cut(s) 29, 83, 125, 376
MspR9I CCNGG 2 cut(s) 177, 186
MvaI CCWGG 2 cut(s) 177, 186
MwoI GCNNNNNNNGC 6 cut(s) 18, 126, 135, 156, 228, 333
NlaIV GGNNCC 2 cut(s) 102, 103
NmeAIII GCCGAG 2 cut(s) 96, 135
PfeI GAWTC 1 cut(s) 181
PkrI GCNGC 4 cut(s) 11, 128, 131, 161
Psp6I CCWGG 2 cut(s) 175, 184
PspFI CCCAGC 1 cut(s) 81
PspGI CCWGG 2 cut(s) 175, 184
PspN4I GGNNCC 2 cut(s) 102, 103
PspOMI GGGCCC 1 cut(s) 100
PspPI GGNCC 3 cut(s) 100, 101, 173
RsaI GTAC 1 cut(s) 287
RsaNI GTAC 1 cut(s) 286
SatI GCNGC 4 cut(s) 10, 127, 130, 160
Sau96I GGNCC 3 cut(s) 100, 101, 173
ScrFI CCNGG 2 cut(s) 177, 186
SduI GDGCHC 2 cut(s) 104, 376
SetI ASST 6 cut(s) 66, 99, 287, 306, 390, 421
SfaNI GCATC 2 cut(s) 153, 209
SinI GGWCC 1 cut(s) 173
SsiI CCGC 4 cut(s) 105, 129, 159, 222
SspMI CTAG 1 cut(s) 89
StyD4I CCNGG 2 cut(s) 175, 184
StyI CCWWGG 1 cut(s) 208
TaaI ACNGT 1 cut(s) 248
TaqI TCGA 1 cut(s) 343
TauI GCSGC 2 cut(s) 132, 162
TfiI GAWTC 1 cut(s) 181
TseI GCWGC 2 cut(s) 9, 126
VneI GTGCAC 1 cut(s) 372
VpaK11BI GGWCC 1 cut(s) 173
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.