MD03G1196700.v1.1

Protein of unknown function (DUF568)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
OG0015575
Physical Location & Seq
Reverse (-)
26909744 .. 26912137
2394 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1196700.v1.1.491

Sequence Viewer

Length: 1011 bp
ATGTTGGGCACTACCAACTCTGTAGTTCTGATCATATTAACGGTTTCCTCCTCACTTCTTTTCCCAATTTCTGAGCAATATTCCAATTGTAGCCGCATCAATCCCATGAACATTACAAACTGCAAGAAACTAGTCACTCTAGGAGCAGAATTCGGGTGGAACATTCACAGCAACACCGAAATTGACATCTTGTTCACCATTAGACCACCTGCCAAATGGATAGCATGGGGTGTGAACCCAGGTCCCCAAAGGGCAGAGATGGTCGGGACCAGGGCTGTTATAGGCATTTCACAGCCTAATGGAACGTTGGTAGTCAGAAAATACAACATCATCAGTGACACCAAGCTAGGTTGTAGGCTTAAGCCTTCACAAGATTTTGATGATGTTATTGTCAAGAACATGAAAGGTGAAGTGAAGCCTAGGAGGTACATGTCGATATTTGCAACGCTAATTTTGCCACCGGATCAAGCCGCGTACAATATTTTGAAGTTGAACCATGTATGGCAAGTAGGGTTTGAGGCTGATGATGCTCTTATGGAGCCTAAGATGCATTCCACTTCTCTCCAGAATGTGGATAGCACGGAGACTATAAACATGACCACAGGACGCGGTCTTAGCATTGGACATCGCCAGCATCACCTCAGAACGGTACATGGGATTCTTAATATTGTGGGGTGGGGAACAATGTTGATACCCTTTTCAATGTCCAAGGTGATGCTTGCCCTGCGTTTAACGCCAACAAAAACTGATGATTACCGGAAATACTGGAACATGTACCATCATTTTCTAGGGTATTCACTGCTGGCTGTGATCTCAGTGAACATATTCCAAGGCATTGCGATTTTGAAGCCGAATAAAACCTGGTTGTGGGTTTACGTCGGAGTACTTGGAATGCTTGGTTTGGTTGCAATTGGTTTGGAGATTTTCACTTGGACTAAGTTCATATATGACTTATATCGCGGAAAGAAGAGCAGGCTCGAATTCCATGACGGGGCCAACCGCTCGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cytochrom_B561 DUF568

Protein Analysis

337

Amino Acids

37.94

Weight (kDa)

9.6

Isoelectric Point (pI)

36.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF568 PF04526 87 - 199 2.5e-18 Protein of unknown function (DUF568)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015575)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g23200
malus_domestica MD03G1196700.v1.1 MD11G1212800.v1.1
prunus_persica Prupe.4G218700_v2.0.a1
pyrus_communis pycom11g18780
rosa_laevigata RLG00000034009
rosa_multiflora Rmu_sc0004953.1_g000005 Rmu_sc0004953.1_g000008
rosa_roxburghii Rroxscaffold_1G00039840
rosa_rugosa Rorug05G0188200 Rorug05G0220100
rosa_samantha Rh5AG273700 Rh5BG278800 Rh5CG310800 Rh5DG287000
rosa_wichuraiana Rw5G025730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 217
Acc36I ACCTGC 1 cut(s) 217
AccB7I CCANNNNNTGG 1 cut(s) 571
AccBSI CCGCTC 1 cut(s) 1002
AccII CGCG 3 cut(s) 473, 609, 960
AciI CCGC 5 cut(s) 94, 471, 609, 960, 1000
AclI AACGTT 1 cut(s) 305
AclWI GGATC 1 cut(s) 471
AcsI RAATTY 2 cut(s) 149, 980
AfaI GTAC 5 cut(s) 428, 476, 651, 776, 885
AfiI CCNNNNNNNGG 4 cut(s) 571, 646, 867, 991
AflII CTTAAG 1 cut(s) 359
AflIII ACRYGT 2 cut(s) 429, 771
AgsI TTSAA 4 cut(s) 487, 493, 702, 847
AhlI ACTAGT 1 cut(s) 130
AjnI CCWGG 3 cut(s) 238, 269, 860
AluBI AGCT 1 cut(s) 346
AluI AGCT 1 cut(s) 346
Alw26I GTCTC 1 cut(s) 578
AlwI GGATC 1 cut(s) 471
AoxI GGCC 1 cut(s) 993
ApoI RAATTY 2 cut(s) 149, 980
Asp700I GAANNNNTTC 1 cut(s) 824
AspA2I CCTAGG 1 cut(s) 419
AspS9I GGNCC 3 cut(s) 242, 267, 993
AsuHPI GGTGA 4 cut(s) 187, 419, 629, 724
AvaII GGWCC 2 cut(s) 242, 267
AvrII CCTAGG 1 cut(s) 419
BaeGI GKGCMC 1 cut(s) 11
BccI CCATC 2 cut(s) 253, 786
BciT130I CCWGG 3 cut(s) 240, 271, 862
BclI TGATCA 1 cut(s) 30
BcoDI GTCTC 1 cut(s) 578
BcuI ACTAGT 1 cut(s) 130
BfaI CTAG 6 cut(s) 131, 140, 347, 420, 788, 1009
BfmI CTRYAG 1 cut(s) 21
BfrI CTTAAG 1 cut(s) 359
BfuAI ACCTGC 1 cut(s) 217
BisI GCNGC 2 cut(s) 94, 471
BlnI CCTAGG 1 cut(s) 419
BlsI GCNGC 2 cut(s) 95, 472
BmcAI AGTACT 1 cut(s) 885
Bme1390I CCNGG 3 cut(s) 240, 271, 862
Bme18I GGWCC 2 cut(s) 242, 267
BmgT120I GGNCC 3 cut(s) 242, 267, 993
BmiI GGNNCC 4 cut(s) 244, 268, 540, 994
BmrFI CCNGG 3 cut(s) 240, 271, 862
BmsI GCATC 5 cut(s) 105, 517, 537, 643, 705
BpmI CTGGAG 1 cut(s) 548
BsaJI CCNNGG 5 cut(s) 238, 270, 419, 708, 829
BsaWI WCCGGW 2 cut(s) 460, 756
Bsc4I CCNNNNNNNGG 4 cut(s) 571, 646, 867, 991
Bse1I ACTGG 1 cut(s) 770
Bse3DI GCAATG 1 cut(s) 834
BseBI CCWGG 3 cut(s) 240, 271, 862
BseDI CCNNGG 5 cut(s) 238, 270, 419, 708, 829
BseLI CCNNNNNNNGG 4 cut(s) 571, 646, 867, 991
BseMI GCAATG 1 cut(s) 834
BseMII CTCAG 3 cut(s) 63, 655, 828
BseNI ACTGG 1 cut(s) 770
BseRI GAGGAG 1 cut(s) 40
BseSI GKGCMC 1 cut(s) 11
Bsh1236I CGCG 3 cut(s) 473, 609, 960
BshFI GGCC 1 cut(s) 995
BsiSI CCGG 2 cut(s) 461, 757
BslFI GGGAC 2 cut(s) 228, 280
BslI CCNNNNNNNGG 4 cut(s) 571, 646, 867, 991
BsmAI GTCTC 1 cut(s) 578
BsmFI GGGAC 2 cut(s) 228, 280
BsmI GAATGC 2 cut(s) 550, 897
BsnI GGCC 1 cut(s) 995
Bsp1286I GDGCHC 1 cut(s) 11
Bsp143I GATC 3 cut(s) 30, 463, 810
BspACI CCGC 5 cut(s) 94, 471, 609, 960, 1000
BspANI GGCC 1 cut(s) 995
BspCNI CTCAG 3 cut(s) 64, 654, 827
BspFNI CGCG 3 cut(s) 473, 609, 960
BspLI GGNNCC 4 cut(s) 244, 268, 540, 994
BspMI ACCTGC 1 cut(s) 217
BspPI GGATC 1 cut(s) 471
BspQI GCTCTTC 1 cut(s) 962
BspTI CTTAAG 1 cut(s) 359
BsrBI CCGCTC 1 cut(s) 1002
BsrDI GCAATG 1 cut(s) 834
BsrI ACTGG 1 cut(s) 770
BssECI CCNNGG 5 cut(s) 238, 270, 419, 708, 829
BssMI GATC 3 cut(s) 30, 463, 810
BssT1I CCWWGG 3 cut(s) 419, 708, 829
Bst2UI CCWGG 3 cut(s) 240, 271, 862
Bst4CI ACNGT 2 cut(s) 43, 649
Bst6I CTCTTC 1 cut(s) 962
BstAFI CTTAAG 1 cut(s) 359
BstC8I GCNNGC 4 cut(s) 632, 720, 804, 974
BstDEI CTNAG 6 cut(s) 72, 543, 614, 641, 814, 936
BstFNI CGCG 3 cut(s) 473, 609, 960
BstKTI GATC 3 cut(s) 33, 466, 813
BstMAI GTCTC 1 cut(s) 578
BstMBI GATC 3 cut(s) 30, 463, 810
BstMWI GCNNNNNNNGC 6 cut(s) 454, 527, 547, 615, 724, 733
BstNI CCWGG 3 cut(s) 240, 271, 862
BstNSI RCATGY 2 cut(s) 433, 775
BstSCI CCNGG 3 cut(s) 238, 269, 860
BstSFI CTRYAG 1 cut(s) 21
BstSLI GKGCMC 1 cut(s) 11
BstUI CGCG 3 cut(s) 473, 609, 960
BsuRI GGCC 1 cut(s) 995
BtgZI GCGATG 1 cut(s) 611
BtsI GCAGTG 1 cut(s) 797
BtsIMutI CAGTG 3 cut(s) 340, 797, 822
BveI ACCTGC 1 cut(s) 217
Cac8I GCNNGC 4 cut(s) 632, 720, 804, 974
Cfr13I GGNCC 3 cut(s) 242, 267, 993
CseI GACGC 1 cut(s) 615
CsiI ACCWGGT 1 cut(s) 860
Csp6I GTAC 5 cut(s) 427, 475, 650, 775, 884
CviAII CATG 9 cut(s) 106, 225, 400, 430, 497, 595, 653, 772, 986
CviQI GTAC 5 cut(s) 427, 475, 650, 775, 884
DdeI CTNAG 6 cut(s) 72, 543, 614, 641, 814, 936
DpnI GATC 3 cut(s) 32, 465, 812
DpnII GATC 3 cut(s) 30, 463, 810
Eam1104I CTCTTC 1 cut(s) 962
EarI CTCTTC 1 cut(s) 962
Eco130I CCWWGG 3 cut(s) 419, 708, 829
Eco47I GGWCC 2 cut(s) 242, 267
EcoO109I RGGNCCY 1 cut(s) 242
EcoRI GAATTC 2 cut(s) 149, 980
EcoRII CCWGG 3 cut(s) 238, 269, 860
EcoT14I CCWWGG 3 cut(s) 419, 708, 829
EcoT22I ATGCAT 1 cut(s) 552
ErhI CCWWGG 3 cut(s) 419, 708, 829
FaeI CATG 9 cut(s) 109, 228, 403, 433, 500, 598, 656, 775, 989
FaqI GGGAC 2 cut(s) 228, 280
FatI CATG 9 cut(s) 105, 224, 399, 429, 496, 594, 652, 771, 985
FbaI TGATCA 1 cut(s) 30
Fnu4HI GCNGC 2 cut(s) 94, 471
Fsp4HI GCNGC 2 cut(s) 94, 471
FspBI CTAG 6 cut(s) 131, 140, 347, 420, 788, 1009
GluI GCNGC 2 cut(s) 94, 471
GsuI CTGGAG 1 cut(s) 548
HaeIII GGCC 1 cut(s) 995
HapII CCGG 2 cut(s) 461, 757
HgaI GACGC 1 cut(s) 615
Hin1II CATG 9 cut(s) 109, 228, 403, 433, 500, 598, 656, 775, 989
HinfI GANTC 1 cut(s) 658
HpaII CCGG 2 cut(s) 461, 757
HphI GGTGA 4 cut(s) 187, 419, 629, 724
Hpy166II GTNNAC 4 cut(s) 195, 235, 820, 874
Hpy188I TCNGA 5 cut(s) 30, 73, 317, 644, 881
Hpy188III TCNNGA 3 cut(s) 265, 394, 565
Hpy8I GTNNAC 4 cut(s) 195, 235, 820, 874
Hpy99I CGWCG 1 cut(s) 881
HpyAV CCTTC 1 cut(s) 375
HpyCH4III ACNGT 2 cut(s) 43, 649
HpyCH4IV ACGT 2 cut(s) 305, 876
HpyCH4V TGCA 4 cut(s) 123, 443, 550, 908
HpyF10VI GCNNNNNNNGC 6 cut(s) 454, 527, 547, 615, 724, 733
HpyF3I CTNAG 6 cut(s) 72, 543, 614, 641, 814, 936
HpySE526I ACGT 2 cut(s) 305, 876
Hsp92II CATG 9 cut(s) 109, 228, 403, 433, 500, 598, 656, 775, 989
Ksp22I TGATCA 1 cut(s) 30
Kzo9I GATC 3 cut(s) 30, 463, 810
LguI GCTCTTC 1 cut(s) 962
LmnI GCTCC 2 cut(s) 143, 538
LweI GCATC 5 cut(s) 105, 517, 537, 643, 705
MabI ACCWGGT 1 cut(s) 860
MaeI CTAG 6 cut(s) 131, 140, 347, 420, 788, 1009
MaeII ACGT 2 cut(s) 305, 876
MaeIII GTNAC 2 cut(s) 133, 335
MalI GATC 3 cut(s) 32, 465, 812
MbiI CCGCTC 1 cut(s) 1002
MboI GATC 3 cut(s) 30, 463, 810
MboII GAAGA 1 cut(s) 979
MfeI CAATTG 2 cut(s) 85, 909
MhlI GDGCHC 1 cut(s) 11
MluCI AATT 7 cut(s) 66, 85, 149, 180, 450, 909, 980
MmeI TCCRAC 1 cut(s) 859
MnlI CCTC 5 cut(s) 58, 61, 417, 511, 650
Mph1103I ATGCAT 1 cut(s) 552
MroXI GAANNNNTTC 1 cut(s) 824
MseI TTAA 4 cut(s) 38, 360, 663, 731
MspCI CTTAAG 1 cut(s) 359
MspI CCGG 2 cut(s) 461, 757
MspR9I CCNGG 3 cut(s) 240, 271, 862
MunI CAATTG 2 cut(s) 85, 909
Mva1269I GAATGC 2 cut(s) 550, 897
MvaI CCWGG 3 cut(s) 240, 271, 862
MvnI CGCG 3 cut(s) 473, 609, 960
MwoI GCNNNNNNNGC 6 cut(s) 454, 527, 547, 615, 724, 733
NdeII GATC 3 cut(s) 30, 463, 810
NlaIII CATG 9 cut(s) 109, 228, 403, 433, 500, 598, 656, 775, 989
NlaIV GGNNCC 4 cut(s) 244, 268, 540, 994
NmuCI GTSAC 2 cut(s) 133, 335
NsiI ATGCAT 1 cut(s) 552
NspI RCATGY 2 cut(s) 433, 775
PaqCI CACCTGC 1 cut(s) 217
PciI ACATGT 2 cut(s) 429, 771
PciSI GCTCTTC 1 cut(s) 962
PctI GAATGC 2 cut(s) 550, 897
PdmI GAANNNNTTC 1 cut(s) 824
PfeI GAWTC 1 cut(s) 658
PflFI GACNNNGTC 1 cut(s) 609
PflMI CCANNNNNTGG 1 cut(s) 571
PkrI GCNGC 2 cut(s) 95, 472
PpuMI RGGWCCY 1 cut(s) 242
PscI ACATGT 2 cut(s) 429, 771
Psp1406I AACGTT 1 cut(s) 305
Psp5II RGGWCCY 1 cut(s) 242
Psp6I CCWGG 3 cut(s) 238, 269, 860
PspGI CCWGG 3 cut(s) 238, 269, 860
PspN4I GGNNCC 4 cut(s) 244, 268, 540, 994
PspPI GGNCC 3 cut(s) 242, 267, 993
PspPPI RGGWCCY 1 cut(s) 242
PsyI GACNNNGTC 1 cut(s) 609
RsaI GTAC 5 cut(s) 428, 476, 651, 776, 885
RsaNI GTAC 5 cut(s) 427, 475, 650, 775, 884
SapI GCTCTTC 1 cut(s) 962
SaqAI TTAA 4 cut(s) 38, 360, 663, 731
SatI GCNGC 2 cut(s) 94, 471
Sau3AI GATC 3 cut(s) 30, 463, 810
Sau96I GGNCC 3 cut(s) 242, 267, 993
ScaI AGTACT 1 cut(s) 885
ScrFI CCNGG 3 cut(s) 240, 271, 862
SduI GDGCHC 1 cut(s) 11
SexAI ACCWGGT 1 cut(s) 860
SfaNI GCATC 5 cut(s) 105, 517, 537, 643, 705
SfcI CTRYAG 1 cut(s) 21
SinI GGWCC 2 cut(s) 242, 267
SmlI CTYRAG 1 cut(s) 359
SmoI CTYRAG 1 cut(s) 359
SpeI ACTAGT 1 cut(s) 130
Sse9I AATT 7 cut(s) 66, 85, 149, 180, 450, 909, 980
SsiI CCGC 5 cut(s) 94, 471, 609, 960, 1000
SspI AATATT 3 cut(s) 80, 481, 667
SspMI CTAG 6 cut(s) 131, 140, 347, 420, 788, 1009
StyD4I CCNGG 3 cut(s) 238, 269, 860
StyI CCWWGG 3 cut(s) 419, 708, 829
TaaI ACNGT 2 cut(s) 43, 649
TaiI ACGT 2 cut(s) 308, 879
TaqI TCGA 3 cut(s) 434, 978, 1004
TasI AATT 7 cut(s) 66, 85, 149, 180, 450, 909, 980
TatI WGTACW 1 cut(s) 883
TauI GCSGC 2 cut(s) 96, 473
TfiI GAWTC 1 cut(s) 658
Tru1I TTAA 4 cut(s) 38, 360, 663, 731
Tru9I TTAA 4 cut(s) 38, 360, 663, 731
TscAI CASTG 3 cut(s) 340, 804, 822
TseFI GTSAC 2 cut(s) 133, 335
Tsp45I GTSAC 2 cut(s) 133, 335
TspDTI ATGAA 3 cut(s) 122, 416, 931
TspGWI ACGGA 1 cut(s) 596
TspRI CASTG 3 cut(s) 340, 804, 822
Tth111I GACNNNGTC 1 cut(s) 609
Van91I CCANNNNNTGG 1 cut(s) 571
Vha464I CTTAAG 1 cut(s) 359
VpaK11BI GGWCC 2 cut(s) 242, 267
XapI RAATTY 2 cut(s) 149, 980
XceI RCATGY 2 cut(s) 433, 775
XcmI CCANNNNNNNNNTGG 1 cut(s) 213
XmaJI CCTAGG 1 cut(s) 419
XmnI GAANNNNTTC 1 cut(s) 824
XspI CTAG 6 cut(s) 131, 140, 347, 420, 788, 1009
ZrmI AGTACT 1 cut(s) 885
Zsp2I ATGCAT 1 cut(s) 552
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.