Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr04

Orthogroup ID

OG0008929

Physical Location & Seq

Genomic Coordinates Forward (+)

30338771 .. 30340506

Gene Structure 1736 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD04G1222900.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 267 bp

ATGTTGGTGCTACTTGTGTGGAGTTCGTTGTATGTCCAACTTTGGTATGGTGTGCTTGATCTTTTGTTGGTGATATTGAAGAATTTCAGTTCTTCGTTTGAATCACCTTTTGTTTTGATCAAGGCACTTATGGTTTGCAAATTTGGAGAAGATGGTAGAGAAATGTTCACTTTCGTTGGCTTTGAACTTGGTCAAGGTGGAGATTGTTGGATTTGTGACCAAGTGGACAACAAGCCAAAATACCTTTCGGCTAATAAAATAGAATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

89

Amino Acids

10.05

Weight (kDa)

4.75

Isoelectric Point (pI)

40.14

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008929)

Species	Orthologous Gene IDs
arabidopsis_thaliana	ATMG00300
fragaria_vesca	FvH4_1g10045 FvH4_1g25743 FvH4_2g16991 FvH4_2g31701 FvH4_4g08662 FvH4_6g44103 FvH4_6g48812
malus_domestica	MD04G1222900.v1.1 MD05G1232300.v1.1 MD05G1288100.v1.1 MD12G1229000.v1.1
prunus_persica	Prupe.1G257900_v2.0.a1
pyrus_communis	pycom13g14690
rosa_chinensis	RchiOBHm_Chr2g0123731 RchiOBHm_Chr2g0123741 RchiOBHm_Chr2g0157311 RchiOBHm_Chr7g0200891
rosa_roxburghii	Rroxscaffold_7G00215990
rosa_wichuraiana	Rw1G024090 Rw2G038200 Rw6G012570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	82, 140
AgsI	TTSAA	3 cut(s)	79, 101, 185
AjuI	GAANNNNNNNTTGG	2 cut(s)	229, 261
ApoI	RAATTY	2 cut(s)	82, 140
Asp700I	GAANNNNTTC	1 cut(s)	83
AsuHPI	GGTGA	2 cut(s)	82, 96
BccI	CCATC	1 cut(s)	146
BclI	TGATCA	1 cut(s)	117
Bsp143I	GATC	2 cut(s)	58, 117
BssMI	GATC	2 cut(s)	58, 117
BstKTI	GATC	2 cut(s)	61, 120
BstMBI	GATC	2 cut(s)	58, 117
CviJI	RGCY	3 cut(s)	180, 235, 251
CviKI_1	RGCY	3 cut(s)	180, 235, 251
DpnI	GATC	2 cut(s)	60, 119
DpnII	GATC	2 cut(s)	58, 117
FaiI	YATR	3 cut(s)	33, 48, 131
FbaI	TGATCA	1 cut(s)	117
HinfI	GANTC	1 cut(s)	101
HphI	GGTGA	2 cut(s)	82, 96
Hpy166II	GTNNAC	2 cut(s)	168, 226
Hpy8I	GTNNAC	2 cut(s)	168, 226
HpyCH4V	TGCA	1 cut(s)	138
Ksp22I	TGATCA	1 cut(s)	117
Kzo9I	GATC	2 cut(s)	58, 117
MaeIII	GTNAC	1 cut(s)	215
MalI	GATC	2 cut(s)	60, 119
MboI	GATC	2 cut(s)	58, 117
MboII	GAAGA	3 cut(s)	84, 91, 161
MluCI	AATT	2 cut(s)	82, 140
MmeI	TCCRAC	2 cut(s)	61, 188
MroXI	GAANNNNTTC	1 cut(s)	83
NdeII	GATC	2 cut(s)	58, 117
NmuCI	GTSAC	1 cut(s)	215
PdmI	GAANNNNTTC	1 cut(s)	83
PfeI	GAWTC	1 cut(s)	101
Sau3AI	GATC	2 cut(s)	58, 117
SetI	ASST	3 cut(s)	109, 199, 246
SgeI	CNNG	7 cut(s)	26, 68, 133, 200, 206, 233, 244
Sse9I	AATT	2 cut(s)	82, 140
TasI	AATT	2 cut(s)	82, 140
TfiI	GAWTC	1 cut(s)	101
TseFI	GTSAC	1 cut(s)	215
Tsp45I	GTSAC	1 cut(s)	215
XapI	RAATTY	2 cut(s)	82, 140
XcmI	CCANNNNNNNNNTGG	1 cut(s)	44
XmnI	GAANNNNTTC	1 cut(s)	83

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.