Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr12

Orthogroup ID

OG0008929

Physical Location & Seq

Genomic Coordinates Forward (+)

30451746 .. 30454869

Gene Structure 3124 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD12G1229000.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 231 bp

ATGGTTTGGGAACGGCAGATTAAAGAGAAGAAAGAGAAGGGTTGCTGTTTTCTATCCTTCCCATTTGTTTGTAATCCCCTTTTGTTAGTAATCACTCAATCAAAGATATTTGTGCTACATTTTGTGGCTTTTGGGAGAGACGAAATTTGGTATATGTTTCCATCTTCTCAATTTGTTCTTTGTGAGAGTGAGAGCTATTGGGTGTATGTGGGATTTGGGTTTGAGAGTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

77

Amino Acids

9.05

Weight (kDa)

5.7

Isoelectric Point (pI)

40.17

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008929)

Species	Orthologous Gene IDs
arabidopsis_thaliana	ATMG00300
fragaria_vesca	FvH4_1g10045 FvH4_1g25743 FvH4_2g16991 FvH4_2g31701 FvH4_4g08662 FvH4_6g44103 FvH4_6g48812
malus_domestica	MD04G1222900.v1.1 MD05G1232300.v1.1 MD05G1288100.v1.1 MD12G1229000.v1.1
prunus_persica	Prupe.1G257900_v2.0.a1
pyrus_communis	pycom13g14690
rosa_chinensis	RchiOBHm_Chr2g0123731 RchiOBHm_Chr2g0123741 RchiOBHm_Chr2g0157311 RchiOBHm_Chr7g0200891
rosa_roxburghii	Rroxscaffold_7G00215990
rosa_wichuraiana	Rw1G024090 Rw2G038200 Rw6G012570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	144
AluBI	AGCT	1 cut(s)	195
AluI	AGCT	1 cut(s)	195
Alw26I	GTCTC	1 cut(s)	132
ApoI	RAATTY	1 cut(s)	144
BccI	CCATC	1 cut(s)	169
BceAI	ACGGC	1 cut(s)	29
BcoDI	GTCTC	1 cut(s)	132
BsmAI	GTCTC	1 cut(s)	132
BsmBI	CGTCTC	1 cut(s)	132
BstMAI	GTCTC	1 cut(s)	132
CviJI	RGCY	2 cut(s)	128, 195
CviKI_1	RGCY	2 cut(s)	128, 195
Esp3I	CGTCTC	1 cut(s)	132
FaiI	YATR	3 cut(s)	153, 155, 207
HpyAV	CCTTC	2 cut(s)	31, 67
MboII	GAAGA	2 cut(s)	40, 156
MluCI	AATT	2 cut(s)	144, 170
MseI	TTAA	2 cut(s)	21, 229
SaqAI	TTAA	2 cut(s)	21, 229
SetI	ASST	1 cut(s)	197
Sse9I	AATT	2 cut(s)	144, 170
TasI	AATT	2 cut(s)	144, 170
Tru1I	TTAA	2 cut(s)	21, 229
Tru9I	TTAA	2 cut(s)	21, 229
XapI	RAATTY	1 cut(s)	144

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.