MD05G1232300.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
Physical Location & Seq
Reverse (-)
36524122 .. 36525005
884 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1232300.v1.1.491

Sequence Viewer

Length: 228 bp
ATGAGCTTGCCAACACTTGTAAACTCCCATTTGGTTGATAGTGGATTATTGGGTGAGCTCCTACTGCTCCGAAGACGTACTCCAGTTACATTGACTGCAACAATCTGTCACAACAAGATTTCCGAATCCGAAAGCTGCGCTGCTGGATTCGACGCAGATGTTGGTGTGTTCGAGGACCAAACGCTTGTCTTGTTAGAATCCATACGAACTTTTTTACTTGATTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.16

Weight (kDa)

4.63

Isoelectric Point (pI)

67.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 79
AluBI AGCT 3 cut(s) 6, 58, 135
AluI AGCT 3 cut(s) 6, 58, 135
Alw21I GWGCWC 1 cut(s) 60
ApeKI GCWGC 2 cut(s) 135, 140
AspLEI GCGC 1 cut(s) 140
AspS9I GGNCC 1 cut(s) 175
AsuHPI GGTGA 1 cut(s) 65
AvaII GGWCC 1 cut(s) 175
BanII GRGCYC 1 cut(s) 60
BbsI GAAGAC 1 cut(s) 79
Bbv12I GWGCWC 1 cut(s) 60
BbvI GCAGC 2 cut(s) 122, 127
BfaI CTAG 1 cut(s) 226
BisI GCNGC 2 cut(s) 136, 141
BlsI GCNGC 2 cut(s) 137, 142
Bme18I GGWCC 1 cut(s) 175
BmgT120I GGNCC 1 cut(s) 175
BpiI GAAGAC 1 cut(s) 79
BpmI CTGGAG 1 cut(s) 66
Bse1I ACTGG 1 cut(s) 83
BseNI ACTGG 1 cut(s) 83
BseXI GCAGC 2 cut(s) 122, 127
BsiHKAI GWGCWC 1 cut(s) 60
Bsp1286I GDGCHC 1 cut(s) 60
BsrI ACTGG 1 cut(s) 83
BstC8I GCNNGC 1 cut(s) 8
BstHHI GCGC 1 cut(s) 140
BstMWI GCNNNNNNNGC 1 cut(s) 64
BstV1I GCAGC 2 cut(s) 122, 127
BstV2I GAAGAC 1 cut(s) 79
Cac8I GCNNGC 1 cut(s) 8
CfoI GCGC 1 cut(s) 140
Cfr13I GGNCC 1 cut(s) 175
CseI GACGC 1 cut(s) 161
Csp6I GTAC 1 cut(s) 78
CviJI RGCY 3 cut(s) 6, 58, 135
CviKI_1 RGCY 3 cut(s) 6, 58, 135
CviQI GTAC 1 cut(s) 78
Ecl136II GAGCTC 1 cut(s) 58
Eco24I GRGCYC 1 cut(s) 60
Eco47I GGWCC 1 cut(s) 175
Eco53kI GAGCTC 1 cut(s) 58
EcoICRI GAGCTC 1 cut(s) 58
EcoT38I GRGCYC 1 cut(s) 60
FaiI YATR 1 cut(s) 203
Fnu4HI GCNGC 2 cut(s) 136, 141
FriOI GRGCYC 1 cut(s) 60
Fsp4HI GCNGC 2 cut(s) 136, 141
FspBI CTAG 1 cut(s) 226
GlaI GCGC 1 cut(s) 139
GluI GCNGC 2 cut(s) 136, 141
GsuI CTGGAG 1 cut(s) 66
HgaI GACGC 1 cut(s) 161
HhaI GCGC 1 cut(s) 140
Hin6I GCGC 1 cut(s) 138
HinP1I GCGC 1 cut(s) 138
HinfI GANTC 3 cut(s) 125, 147, 197
HphI GGTGA 1 cut(s) 65
Hpy166II GTNNAC 1 cut(s) 22
Hpy188I TCNGA 3 cut(s) 71, 124, 130
Hpy8I GTNNAC 1 cut(s) 22
Hpy99I CGWCG 1 cut(s) 155
HpyCH4IV ACGT 1 cut(s) 76
HpyCH4V TGCA 1 cut(s) 98
HpyF10VI GCNNNNNNNGC 1 cut(s) 64
HpySE526I ACGT 1 cut(s) 76
HspAI GCGC 1 cut(s) 138
LmnI GCTCC 2 cut(s) 63, 72
LpnPI CCDG 2 cut(s) 96, 129
Lsp1109I GCAGC 2 cut(s) 122, 127
MaeI CTAG 1 cut(s) 226
MaeII ACGT 1 cut(s) 76
MaeIII GTNAC 2 cut(s) 85, 107
MboII GAAGA 1 cut(s) 84
MhlI GDGCHC 1 cut(s) 60
MnlI CCTC 1 cut(s) 166
MwoI GCNNNNNNNGC 1 cut(s) 64
NmuCI GTSAC 1 cut(s) 107
PfeI GAWTC 3 cut(s) 125, 147, 197
PkrI GCNGC 2 cut(s) 137, 142
Psp124BI GAGCTC 1 cut(s) 60
PspPI GGNCC 1 cut(s) 175
RsaI GTAC 1 cut(s) 79
RsaNI GTAC 1 cut(s) 78
SacI GAGCTC 1 cut(s) 60
SatI GCNGC 2 cut(s) 136, 141
Sau96I GGNCC 1 cut(s) 175
SduI GDGCHC 1 cut(s) 60
SetI ASST 4 cut(s) 8, 60, 79, 137
SgeI CNNG 8 cut(s) 19, 29, 95, 127, 156, 184, 197, 202
SinI GGWCC 1 cut(s) 175
SspMI CTAG 1 cut(s) 226
SstI GAGCTC 1 cut(s) 60
TaiI ACGT 1 cut(s) 79
TaqI TCGA 2 cut(s) 150, 171
TfiI GAWTC 3 cut(s) 125, 147, 197
TseFI GTSAC 1 cut(s) 107
TseI GCWGC 2 cut(s) 135, 140
Tsp45I GTSAC 1 cut(s) 107
VpaK11BI GGWCC 1 cut(s) 175
XspI CTAG 1 cut(s) 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.