MD05G1010100.v1.1

Encoded by

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
Physical Location & Seq
Reverse (-)
2086312 .. 2086725
414 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1010100.v1.1.491

Sequence Viewer

Length: 414 bp
ATGGCTGTGCATATTAGAAGTGCAGTGGTGTTAACATTTCTTCTGATGCTAACAAGTACATGTTACGCCGATATCATCAATCCCATAACTCATGTCACAATTATTAACTATTTACGTAATGGTCGCGACCTTACAGTTCACTGTAAGTCCGCGGATGATGATGTTGGTGTTCATGTGATACCCCCTAATGGGTCCTTTGAGTTCCATTTTCGACCAAATTTTTGGAATTCAACGCAATATTATTGCAAATTTGACTGGGAAGGCGGATCTTACTGGTTTGACATATACATACAACTTAGAGACAAGCCTAACTGCGTGAAGAATTGTAATTGGCTCATCATACCAAATGGTGCATGCAGGCAAATTGAAGGAAGGCCAGATTTGGTGGACAGGTGCTATCCTTGGAATTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

138

Amino Acids

15.95

Weight (kDa)

6.48

Isoelectric Point (pI)

26.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 31 - 135 7e-29 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 126, 152
AciI CCGC 3 cut(s) 150, 152, 264
AclWI GGATC 1 cut(s) 274
AcsI RAATTY 4 cut(s) 217, 226, 248, 406
AfaI GTAC 1 cut(s) 58
AfiI CCNNNNNNNGG 2 cut(s) 188, 189
AflIII ACRYGT 1 cut(s) 59
AgsI TTSAA 2 cut(s) 231, 368
Alw26I GTCTC 1 cut(s) 294
AlwI GGATC 1 cut(s) 274
AoxI GGCC 1 cut(s) 374
ApoI RAATTY 4 cut(s) 217, 226, 248, 406
ArsI GACNNNNNNTTYG 2 cut(s) 204, 236
AspS9I GGNCC 1 cut(s) 192
AvaII GGWCC 1 cut(s) 192
BcoDI GTCTC 1 cut(s) 294
Bme18I GGWCC 1 cut(s) 192
BmgT120I GGNCC 1 cut(s) 192
BmiI GGNNCC 1 cut(s) 193
BmrI ACTGGG 1 cut(s) 265
BmsI GCATC 1 cut(s) 36
BmuI ACTGGG 1 cut(s) 265
BsaAI YACGTR 1 cut(s) 116
BsaJI CCNNGG 2 cut(s) 150, 401
Bsc4I CCNNNNNNNGG 2 cut(s) 188, 189
Bse1I ACTGG 2 cut(s) 260, 278
BseDI CCNNGG 2 cut(s) 150, 401
BseGI GGATG 1 cut(s) 160
BseLI CCNNNNNNNGG 2 cut(s) 188, 189
BseNI ACTGG 2 cut(s) 260, 278
BsgI GTGCAG 1 cut(s) 42
Bsh1236I CGCG 2 cut(s) 126, 152
BshFI GGCC 1 cut(s) 376
BslI CCNNNNNNNGG 2 cut(s) 188, 189
BsmAI GTCTC 1 cut(s) 294
BsnI GGCC 1 cut(s) 376
Bsp143I GATC 1 cut(s) 266
Bsp68I TCGCGA 1 cut(s) 126
BspACI CCGC 3 cut(s) 150, 152, 264
BspANI GGCC 1 cut(s) 376
BspFNI CGCG 2 cut(s) 126, 152
BspLI GGNNCC 1 cut(s) 193
BspPI GGATC 1 cut(s) 274
BsrI ACTGG 2 cut(s) 260, 278
BssECI CCNNGG 2 cut(s) 150, 401
BssMI GATC 1 cut(s) 266
BssT1I CCWWGG 1 cut(s) 401
Bst4CI ACNGT 2 cut(s) 136, 143
BstBAI YACGTR 1 cut(s) 116
BstC8I GCNNGC 2 cut(s) 355, 359
BstDEI CTNAG 1 cut(s) 296
BstDSI CCRYGG 1 cut(s) 150
BstF5I GGATG 1 cut(s) 160
BstFNI CGCG 2 cut(s) 126, 152
BstKTI GATC 1 cut(s) 269
BstMAI GTCTC 1 cut(s) 294
BstMBI GATC 1 cut(s) 266
BstNSI RCATGY 2 cut(s) 63, 357
BstSNI TACGTA 1 cut(s) 116
BstUI CGCG 2 cut(s) 126, 152
BstX2I RGATCY 1 cut(s) 266
BstXI CCANNNNNNTGG 1 cut(s) 222
BstYI RGATCY 1 cut(s) 266
BsuRI GGCC 1 cut(s) 376
BtgI CCRYGG 1 cut(s) 150
BtsCI GGATG 1 cut(s) 160
BtsI GCAGTG 1 cut(s) 30
BtsIMutI CAGTG 2 cut(s) 30, 139
BtuMI TCGCGA 1 cut(s) 126
Cac8I GCNNGC 2 cut(s) 355, 359
Cfr13I GGNCC 1 cut(s) 192
Cfr42I CCGCGG 1 cut(s) 153
Csp6I GTAC 1 cut(s) 57
CviAII CATG 4 cut(s) 60, 92, 173, 354
CviJI RGCY 4 cut(s) 5, 307, 334, 376
CviKI_1 RGCY 4 cut(s) 5, 307, 334, 376
CviQI GTAC 1 cut(s) 57
DdeI CTNAG 1 cut(s) 296
DpnI GATC 1 cut(s) 268
DpnII GATC 1 cut(s) 266
EciI GGCGGA 1 cut(s) 279
Eco105I TACGTA 1 cut(s) 116
Eco130I CCWWGG 1 cut(s) 401
Eco32I GATATC 1 cut(s) 73
Eco47I GGWCC 1 cut(s) 192
EcoO109I RGGNCCY 1 cut(s) 192
EcoRI GAATTC 2 cut(s) 226, 406
EcoRV GATATC 1 cut(s) 73
EcoT14I CCWWGG 1 cut(s) 401
ErhI CCWWGG 1 cut(s) 401
FaeI CATG 4 cut(s) 63, 95, 176, 357
FatI CATG 4 cut(s) 59, 91, 172, 353
FokI GGATG 1 cut(s) 167
HaeIII GGCC 1 cut(s) 376
Hin1II CATG 4 cut(s) 63, 95, 176, 357
HincII GTYRAC 1 cut(s) 33
HindII GTYRAC 1 cut(s) 33
HpaI GTTAAC 1 cut(s) 33
Hpy166II GTNNAC 3 cut(s) 33, 139, 388
Hpy188I TCNGA 1 cut(s) 45
Hpy188III TCNNGA 1 cut(s) 125
Hpy8I GTNNAC 3 cut(s) 33, 139, 388
HpyAV CCTTC 3 cut(s) 254, 362, 366
HpyCH4III ACNGT 2 cut(s) 136, 143
HpyCH4IV ACGT 1 cut(s) 115
HpyCH4V TGCA 5 cut(s) 10, 23, 246, 353, 357
HpyF3I CTNAG 1 cut(s) 296
HpySE526I ACGT 1 cut(s) 115
Hsp92II CATG 4 cut(s) 63, 95, 176, 357
KspAI GTTAAC 1 cut(s) 33
KspI CCGCGG 1 cut(s) 153
Kzo9I GATC 1 cut(s) 266
LpnPI CCDG 5 cut(s) 241, 259, 343, 376, 390
LweI GCATC 1 cut(s) 36
MaeII ACGT 1 cut(s) 115
MaeIII GTNAC 2 cut(s) 62, 94
MalI GATC 1 cut(s) 268
MboI GATC 1 cut(s) 266
MboII GAAGA 2 cut(s) 32, 331
MflI RGATCY 1 cut(s) 266
MluCI AATT 8 cut(s) 99, 217, 226, 248, 322, 328, 363, 406
MseI TTAA 2 cut(s) 32, 105
MspA1I CMGCKG 1 cut(s) 152
MvnI CGCG 2 cut(s) 126, 152
NdeII GATC 1 cut(s) 266
NlaIII CATG 4 cut(s) 63, 95, 176, 357
NlaIV GGNNCC 1 cut(s) 193
NmuCI GTSAC 1 cut(s) 94
NruI TCGCGA 1 cut(s) 126
NspI RCATGY 2 cut(s) 63, 357
PaeI GCATGC 1 cut(s) 357
PciI ACATGT 1 cut(s) 59
Ppu21I YACGTR 1 cut(s) 116
PpuMI RGGWCCY 1 cut(s) 192
PscI ACATGT 1 cut(s) 59
Psp5II RGGWCCY 1 cut(s) 192
PspN4I GGNNCC 1 cut(s) 193
PspPI GGNCC 1 cut(s) 192
PspPPI RGGWCCY 1 cut(s) 192
PsuI RGATCY 1 cut(s) 266
RruI TCGCGA 1 cut(s) 126
RsaI GTAC 1 cut(s) 58
RsaNI GTAC 1 cut(s) 57
SacII CCGCGG 1 cut(s) 153
SaqAI TTAA 2 cut(s) 32, 105
Sau3AI GATC 1 cut(s) 266
Sau96I GGNCC 1 cut(s) 192
SetI ASST 3 cut(s) 118, 132, 395
SfaNI GCATC 1 cut(s) 36
Sfr303I CCGCGG 1 cut(s) 153
SgrBI CCGCGG 1 cut(s) 153
SinI GGWCC 1 cut(s) 192
SnaBI TACGTA 1 cut(s) 116
SphI GCATGC 1 cut(s) 357
Sse9I AATT 8 cut(s) 99, 217, 226, 248, 322, 328, 363, 406
SsiI CCGC 3 cut(s) 150, 152, 264
SspI AATATT 1 cut(s) 239
StyI CCWWGG 1 cut(s) 401
TaaI ACNGT 2 cut(s) 136, 143
TaiI ACGT 1 cut(s) 118
TaqI TCGA 1 cut(s) 211
TasI AATT 8 cut(s) 99, 217, 226, 248, 322, 328, 363, 406
TatI WGTACW 1 cut(s) 56
Tru1I TTAA 2 cut(s) 32, 105
Tru9I TTAA 2 cut(s) 32, 105
TscAI CASTG 2 cut(s) 30, 146
TseFI GTSAC 1 cut(s) 94
Tsp45I GTSAC 1 cut(s) 94
TspDTI ATGAA 2 cut(s) 161, 399
TspRI CASTG 2 cut(s) 30, 146
VpaK11BI GGWCC 1 cut(s) 192
XapI RAATTY 4 cut(s) 217, 226, 248, 406
XceI RCATGY 2 cut(s) 63, 357
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.