MD05G1145800.v1.1

Tetraketide alpha-pyrone reductase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0008638
Physical Location & Seq
Reverse (-)
27687895 .. 27688511
617 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1145800.v1.1.491

Sequence Viewer

Length: 429 bp
ATGCCGAATTTATTGATCTGTGCTATTACATTTCTTAAGCTCAATATTTGGTACCCTATGTCGAAAATTTTAGCTGAGGAAGCAGGATGGGATTTCTGCAAAGAAAATGGGATTGATATGGTCACAGTCCTACCCTCGTTCGTGATCGGACCTTGTTTGCCACCTGAGTTGTGTTCTACTGCATCAGATGTTCTTGGCCTGCTTAAAGGGGAAACAGAGAAATTTAAGTGGCATGGAAGGATGGGATATGTTCATATTGATGATGTTGCACTCTGTCACATCTTAGTTTATGAGCATGAAAGTGCTCATGGCAGATATATTTGTAGCTCAACGGTTACGAACAACACTGAGTTGGGTTCCTTATTATCTACAAGATATCCTTCCTTGCCTATCCCCACAAAGTTTGATATTTTTACCAGCTACAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Epimerase UFD1

Protein Analysis

143

Amino Acids

15.92

Weight (kDa)

5.43

Isoelectric Point (pI)

38.67

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Epimerase PF01370 17 - 103 4.1e-06 NAD dependent epimerase/dehydratase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 51
AccB1I GGYRCC 1 cut(s) 51
AcsI RAATTY 3 cut(s) 7, 66, 221
AfaI GTAC 1 cut(s) 53
AflII CTTAAG 1 cut(s) 35
AluBI AGCT 4 cut(s) 40, 74, 327, 420
AluI AGCT 4 cut(s) 40, 74, 327, 420
Alw21I GWGCWC 1 cut(s) 307
AoxI GGCC 1 cut(s) 196
ApoI RAATTY 3 cut(s) 7, 66, 221
Asp718I GGTACC 1 cut(s) 51
AspS9I GGNCC 1 cut(s) 149
AvaII GGWCC 1 cut(s) 149
BanI GGYRCC 1 cut(s) 51
Bbv12I GWGCWC 1 cut(s) 307
BbvCI CCTCAGC 1 cut(s) 75
BccI CCATC 2 cut(s) 81, 235
BfrI CTTAAG 1 cut(s) 35
Bme18I GGWCC 1 cut(s) 149
BmgT120I GGNCC 1 cut(s) 149
BmiI GGNNCC 2 cut(s) 53, 358
BmsI GCATC 1 cut(s) 191
Bpu10I CCTNAGC 1 cut(s) 75
BseGI GGATG 2 cut(s) 92, 246
BseMII CTCAG 3 cut(s) 66, 156, 339
BshFI GGCC 1 cut(s) 198
BshNI GGYRCC 1 cut(s) 51
BsiHKAI GWGCWC 1 cut(s) 307
BsnI GGCC 1 cut(s) 198
Bsp1286I GDGCHC 1 cut(s) 307
Bsp143I GATC 2 cut(s) 15, 144
BspANI GGCC 1 cut(s) 198
BspCNI CTCAG 3 cut(s) 67, 157, 340
BspLI GGNNCC 2 cut(s) 53, 358
BspT107I GGYRCC 1 cut(s) 51
BspTI CTTAAG 1 cut(s) 35
BssMI GATC 2 cut(s) 15, 144
Bst4CI ACNGT 2 cut(s) 127, 334
BstAFI CTTAAG 1 cut(s) 35
BstC8I GCNNGC 1 cut(s) 200
BstDEI CTNAG 4 cut(s) 75, 165, 283, 348
BstF5I GGATG 2 cut(s) 92, 246
BstKTI GATC 2 cut(s) 18, 147
BstMBI GATC 2 cut(s) 15, 144
BstMWI GCNNNNNNNGC 1 cut(s) 80
BsuRI GGCC 1 cut(s) 198
BtsCI GGATG 2 cut(s) 92, 246
BtsIMutI CAGTG 1 cut(s) 345
Cac8I GCNNGC 1 cut(s) 200
Cfr13I GGNCC 1 cut(s) 149
Csp6I GTAC 1 cut(s) 52
CspCI CAANNNNNGTGG 4 cut(s) 150, 185, 385, 420
CviAII CATG 3 cut(s) 233, 296, 308
CviJI RGCY 5 cut(s) 40, 74, 198, 327, 420
CviKI_1 RGCY 5 cut(s) 40, 74, 198, 327, 420
CviQI GTAC 1 cut(s) 52
DdeI CTNAG 4 cut(s) 75, 165, 283, 348
DpnI GATC 2 cut(s) 17, 146
DpnII GATC 2 cut(s) 15, 144
Eco32I GATATC 1 cut(s) 377
Eco47I GGWCC 1 cut(s) 149
EcoRV GATATC 1 cut(s) 377
FaeI CATG 3 cut(s) 236, 299, 311
FaiI YATR 9 cut(s) 59, 119, 234, 249, 255, 291, 297, 309, 318
FalI AAGNNNNNCTT 2 cut(s) 364, 396
FatI CATG 3 cut(s) 232, 295, 307
FokI GGATG 2 cut(s) 99, 253
HaeIII GGCC 1 cut(s) 198
Hin1II CATG 3 cut(s) 236, 299, 311
Hpy188I TCNGA 2 cut(s) 149, 187
Hpy188III TCNNGA 1 cut(s) 142
HpyAV CCTTC 2 cut(s) 231, 390
HpyCH4III ACNGT 2 cut(s) 127, 334
HpyCH4V TGCA 3 cut(s) 99, 182, 269
HpyF10VI GCNNNNNNNGC 1 cut(s) 80
HpyF3I CTNAG 4 cut(s) 75, 165, 283, 348
Hsp92II CATG 3 cut(s) 236, 299, 311
KpnI GGTACC 1 cut(s) 55
Kzo9I GATC 2 cut(s) 15, 144
LpnPI CCDG 3 cut(s) 69, 177, 212
LweI GCATC 1 cut(s) 191
MaeIII GTNAC 3 cut(s) 121, 275, 334
MalI GATC 2 cut(s) 17, 146
MboI GATC 2 cut(s) 15, 144
MhlI GDGCHC 1 cut(s) 307
MluCI AATT 4 cut(s) 7, 66, 221, 424
MnlI CCTC 2 cut(s) 70, 145
MseI TTAA 4 cut(s) 36, 204, 225, 427
MslI CAYNNNNRTG 2 cut(s) 258, 300
MspCI CTTAAG 1 cut(s) 35
MwoI GCNNNNNNNGC 1 cut(s) 80
NdeII GATC 2 cut(s) 15, 144
NlaIII CATG 3 cut(s) 236, 299, 311
NlaIV GGNNCC 2 cut(s) 53, 358
NmuCI GTSAC 2 cut(s) 121, 275
PspN4I GGNNCC 2 cut(s) 53, 358
PspPI GGNCC 1 cut(s) 149
RsaI GTAC 1 cut(s) 53
RsaNI GTAC 1 cut(s) 52
RseI CAYNNNNRTG 2 cut(s) 258, 300
SaqAI TTAA 4 cut(s) 36, 204, 225, 427
Sau3AI GATC 2 cut(s) 15, 144
Sau96I GGNCC 1 cut(s) 149
SduI GDGCHC 1 cut(s) 307
SetI ASST 6 cut(s) 42, 76, 154, 166, 329, 422
SfaNI GCATC 1 cut(s) 191
SinI GGWCC 1 cut(s) 149
SmiMI CAYNNNNRTG 2 cut(s) 258, 300
SmlI CTYRAG 1 cut(s) 35
SmoI CTYRAG 1 cut(s) 35
Sse9I AATT 4 cut(s) 7, 66, 221, 424
SspI AATATT 1 cut(s) 46
TaaI ACNGT 2 cut(s) 127, 334
TaqI TCGA 1 cut(s) 62
TasI AATT 4 cut(s) 7, 66, 221, 424
Tru1I TTAA 4 cut(s) 36, 204, 225, 427
Tru9I TTAA 4 cut(s) 36, 204, 225, 427
TscAI CASTG 1 cut(s) 352
TseFI GTSAC 2 cut(s) 121, 275
Tsp45I GTSAC 2 cut(s) 121, 275
TspDTI ATGAA 2 cut(s) 242, 312
TspRI CASTG 1 cut(s) 352
Vha464I CTTAAG 1 cut(s) 35
VpaK11BI GGWCC 1 cut(s) 149
XapI RAATTY 3 cut(s) 7, 66, 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.