Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0037975.1

Orthogroup ID

OG0008638

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 820

Gene Structure 820 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0037975.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 470 bp

ctgagagggcagcattggatttctgcaaagcaaatgggatcgatttagtaaccgttctacccacattcgtcgttggaccgagtttgccacctgatttatgttctactgcatctgatatacttggcctgctcaagggtgaaacagagaggttcaaattgcatggaagaatgggatatgttcacatcgatgatgttgcactttgccacatcctagtttatgagcacaaaagtgctcatggtcgatacatttgcaactcgacagtgcttgacaacaatgagttagcatccttgctatccacaagatatccttccatacctatccctgaaaggtttgagcaactggaaaggccacactatgatttcaacacctcaaagatgagggctctaggatttaagttcaagacagtccaagagatgtttgatgattgcattgccgctctggtggagcaaggccatctttctccattctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Epimerase UFD1

Protein Analysis

155

Amino Acids

17.4

Weight (kDa)

5.76

Isoelectric Point (pI)

32.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008638)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G35420
fragaria_vesca	FvH4_2g17230
malus_domestica	MD05G1145800.v1.1 MD05G1148800.v1.1 MD05G1148900.v1.1 MD10G1145200.v1.1 MD10G1145300.v1.1
prunus_persica	Prupe.8G183600_v2.0.a1 Prupe.8G183600_v2.0.a1
pyrus_communis	pycom05g14050 pycom10g12510 pycom10g12520
rosa_chinensis	RchiOBHm_Chr6g0281711
rosa_laevigata	RLG00000012944 RLG00000012947
rosa_multiflora	Rmu_sc0037975.1_g000001
rosa_roxburghii	Rroxscaffold_7G00186890
rosa_rugosa	Rorug06G0142700
rosa_samantha	Rh6AG255700 Rh6BG258800 Rh6CG257700 Rh6DG249800
rosa_wichuraiana	Rw6G022160

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	436
AciI	CCGC	1 cut(s)	434
AclWI	GGATC	1 cut(s)	46
AfiI	CCNNNNNNNGG	1 cut(s)	132
AgsI	TTSAA	3 cut(s)	153, 363, 399
AleI	CACNNNNGTG	1 cut(s)	227
Alw21I	GWGCWC	2 cut(s)	224, 234
AlwI	GGATC	1 cut(s)	46
AoxI	GGCC	3 cut(s)	123, 346, 450
ApeKI	GCWGC	1 cut(s)	10
AspS9I	GGNCC	1 cut(s)	76
AsuHPI	GGTGA	1 cut(s)	148
AvaII	GGWCC	1 cut(s)	76
BanII	GRGCYC	1 cut(s)	384
Bbv12I	GWGCWC	2 cut(s)	224, 234
BbvI	GCAGC	1 cut(s)	22
BccI	CCATC	1 cut(s)	461
BcgI	CGANNNNNNTGC	4 cut(s)	175, 209, 230, 264
BfaI	CTAG	3 cut(s)	211, 385, 468
BisI	GCNGC	2 cut(s)	11, 434
BlsI	GCNGC	2 cut(s)	12, 435
Bme18I	GGWCC	1 cut(s)	76
BmgT120I	GGNCC	1 cut(s)	76
BmsI	GCATC	2 cut(s)	118, 292
BpuEI	CTTGAG	1 cut(s)	115
Bsa29I	ATCGAT	2 cut(s)	41, 185
Bsc4I	CCNNNNNNNGG	1 cut(s)	132
Bse1I	ACTGG	1 cut(s)	344
Bse3DI	GCAATG	1 cut(s)	428
BseCI	ATCGAT	2 cut(s)	41, 185
BseGI	GGATG	2 cut(s)	206, 283
BseLI	CCNNNNNNNGG	1 cut(s)	132
BseMI	GCAATG	1 cut(s)	428
BseNI	ACTGG	1 cut(s)	344
BseXI	GCAGC	1 cut(s)	22
BshFI	GGCC	3 cut(s)	125, 348, 452
BshVI	ATCGAT	2 cut(s)	41, 185
BsiHKAI	GWGCWC	2 cut(s)	224, 234
BslI	CCNNNNNNNGG	1 cut(s)	132
BsnI	GGCC	3 cut(s)	125, 348, 452
Bsp1286I	GDGCHC	3 cut(s)	224, 234, 384
Bsp143I	GATC	1 cut(s)	38
BspACI	CCGC	1 cut(s)	434
BspANI	GGCC	3 cut(s)	125, 348, 452
BspDI	ATCGAT	2 cut(s)	41, 185
BspPI	GGATC	1 cut(s)	46
BsrBI	CCGCTC	1 cut(s)	436
BsrDI	GCAATG	1 cut(s)	428
BsrI	ACTGG	1 cut(s)	344
BssMI	GATC	1 cut(s)	38
Bst4CI	ACNGT	3 cut(s)	54, 261, 405
BstC8I	GCNNGC	1 cut(s)	127
BstDEI	CTNAG	1 cut(s)	2
BstENI	CCTNNNNNAGG	1 cut(s)	130
BstF5I	GGATG	2 cut(s)	206, 283
BstKTI	GATC	1 cut(s)	41
BstMBI	GATC	1 cut(s)	38
BstV1I	GCAGC	1 cut(s)	22
Bsu15I	ATCGAT	2 cut(s)	41, 185
BsuRI	GGCC	3 cut(s)	125, 348, 452
BsuTUI	ATCGAT	2 cut(s)	41, 185
BtsCI	GGATG	2 cut(s)	206, 283
BtsIMutI	CAGTG	1 cut(s)	266
Cac8I	GCNNGC	1 cut(s)	127
Cfr13I	GGNCC	1 cut(s)	76
ClaI	ATCGAT	2 cut(s)	41, 185
CviAII	CATG	2 cut(s)	160, 235
CviJI	RGCY	4 cut(s)	125, 348, 382, 452
CviKI_1	RGCY	4 cut(s)	125, 348, 382, 452
DdeI	CTNAG	1 cut(s)	2
DpnI	GATC	1 cut(s)	40
DpnII	GATC	1 cut(s)	38
Eco24I	GRGCYC	1 cut(s)	384
Eco32I	GATATC	1 cut(s)	304
Eco47I	GGWCC	1 cut(s)	76
EcoNI	CCTNNNNNAGG	1 cut(s)	130
EcoRV	GATATC	1 cut(s)	304
EcoT38I	GRGCYC	1 cut(s)	384
FaeI	CATG	2 cut(s)	163, 238
FaiI	YATR	8 cut(s)	99, 118, 161, 176, 218, 236, 313, 356
FalI	AAGNNNNNCTT	3 cut(s)	291, 323, 440
FatI	CATG	2 cut(s)	159, 234
Fnu4HI	GCNGC	2 cut(s)	11, 434
FokI	GGATG	2 cut(s)	193, 270
FriOI	GRGCYC	1 cut(s)	384
Fsp4HI	GCNGC	2 cut(s)	11, 434
FspBI	CTAG	3 cut(s)	211, 385, 468
GluI	GCNGC	2 cut(s)	11, 434
HaeIII	GGCC	3 cut(s)	125, 348, 452
Hin1II	CATG	2 cut(s)	163, 238
HphI	GGTGA	1 cut(s)	148
Hpy166II	GTNNAC	1 cut(s)	180
Hpy188I	TCNGA	1 cut(s)	114
Hpy188III	TCNNGA	1 cut(s)	399
Hpy8I	GTNNAC	1 cut(s)	180
Hpy99I	CGWCG	1 cut(s)	73
HpyAV	CCTTC	1 cut(s)	317
HpyCH4III	ACNGT	3 cut(s)	54, 261, 405
HpyCH4V	TGCA	6 cut(s)	26, 109, 159, 196, 251, 428
HpyF3I	CTNAG	1 cut(s)	2
Hsp92II	CATG	2 cut(s)	163, 238
Kzo9I	GATC	1 cut(s)	38
LmnI	GCTCC	1 cut(s)	444
LpnPI	CCDG	5 cut(s)	104, 139, 325, 335, 424
Lsp1109I	GCAGC	1 cut(s)	22
LweI	GCATC	2 cut(s)	118, 292
MaeI	CTAG	3 cut(s)	211, 385, 468
MaeIII	GTNAC	1 cut(s)	48
MalI	GATC	1 cut(s)	40
MbiI	CCGCTC	1 cut(s)	436
MboI	GATC	1 cut(s)	38
MboII	GAAGA	1 cut(s)	176
MhlI	GDGCHC	3 cut(s)	224, 234, 384
MluCI	AATT	1 cut(s)	154
MmeI	TCCRAC	1 cut(s)	54
MnlI	CCTC	3 cut(s)	140, 371, 378
MseI	TTAA	1 cut(s)	392
MslI	CAYNNNNRTG	2 cut(s)	185, 227
NdeII	GATC	1 cut(s)	38
NlaIII	CATG	2 cut(s)	163, 238
OliI	CACNNNNGTG	1 cut(s)	227
PkrI	GCNGC	2 cut(s)	12, 435
PspPI	GGNCC	1 cut(s)	76
RseI	CAYNNNNRTG	2 cut(s)	185, 227
SaqAI	TTAA	1 cut(s)	392
SatI	GCNGC	2 cut(s)	11, 434
Sau3AI	GATC	1 cut(s)	38
Sau96I	GGNCC	1 cut(s)	76
SduI	GDGCHC	3 cut(s)	224, 234, 384
SetI	ASST	5 cut(s)	93, 151, 318, 331, 370
SfaNI	GCATC	2 cut(s)	118, 292
SinI	GGWCC	1 cut(s)	76
SmiMI	CAYNNNNRTG	2 cut(s)	185, 227
SmlI	CTYRAG	1 cut(s)	130
SmoI	CTYRAG	1 cut(s)	130
Sse9I	AATT	1 cut(s)	154
SsiI	CCGC	1 cut(s)	434
SspMI	CTAG	3 cut(s)	211, 385, 468
TaaI	ACNGT	3 cut(s)	54, 261, 405
TaqI	TCGA	4 cut(s)	41, 185, 240, 256
TaqII	GACCGA	1 cut(s)	93
TasI	AATT	1 cut(s)	154
TauI	GCSGC	1 cut(s)	436
Tru1I	TTAA	1 cut(s)	392
Tru9I	TTAA	1 cut(s)	392
TscAI	CASTG	1 cut(s)	266
TseI	GCWGC	1 cut(s)	10
TspRI	CASTG	1 cut(s)	266
VpaK11BI	GGWCC	1 cut(s)	76
XagI	CCTNNNNNAGG	1 cut(s)	130
XspI	CTAG	3 cut(s)	211, 385, 468

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.