Rorug06G0142700

Tetraketide alpha-pyrone reductase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
OG0008638
Physical Location & Seq
Reverse (-)
20281171 .. 20283601
2431 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0142700.1

Sequence Viewer

Length: 414 bp
ATGTCATCTGGAGGGTACTATAGACTAGATGAAACATCGGAAGGTACTGCCGACCAGACTATTACCTGGAGGGTACTGCCGACCAGGGATTGTGGTCTATCTATCCATAGGGTGGAGGGCTGTGATTTGTTCTTTGTAAAGGAAAAGGATGCACTGAAGGCTATGCCGCCAGTAGGTGCGATGTCTTGGCTGTCCATCGTTTCTGCCATGGGGAGTTCTCAAGATTCGGTTGCTTCTAGGTTTTCTATTAACCCTAGCGTTGCAGGGAATCTAGGTTTTCTAAACCAGGAAGCGGCAAAGCAAGCCTTTCAACATAGGAAACATGCTGTCTTTTTCTCTAAACATCTGAACTCCGGGTTGCAAGCTACTGGCCTGCTGAAGAAACTTATCACACCTGTGCCGCCAGTGTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Epimerase UFD1

Protein Analysis

137

Amino Acids

14.87

Weight (kDa)

9.03

Isoelectric Point (pI)

41.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 412
AccB7I CCANNNNNTGG 1 cut(s) 112
AciI CCGC 3 cut(s) 167, 293, 401
AcuI CTGAAG 2 cut(s) 176, 398
AfaI GTAC 3 cut(s) 17, 46, 75
AfiI CCNNNNNNNGG 3 cut(s) 112, 173, 292
AgsI TTSAA 1 cut(s) 311
AjnI CCWGG 3 cut(s) 65, 83, 285
AleI CACNNNNGTG 1 cut(s) 395
AluBI AGCT 1 cut(s) 365
AluI AGCT 1 cut(s) 365
AoxI GGCC 1 cut(s) 370
AsuC2I CCSGG 1 cut(s) 355
BccI CCATC 1 cut(s) 203
BciT130I CCWGG 3 cut(s) 67, 85, 287
BcnI CCSGG 1 cut(s) 355
BfaI CTAG 4 cut(s) 26, 237, 255, 272
BfmI CTRYAG 1 cut(s) 19
BisI GCNGC 3 cut(s) 167, 294, 401
BlsI GCNGC 3 cut(s) 168, 295, 402
Bme1390I CCNGG 4 cut(s) 67, 85, 287, 355
BmrFI CCNGG 4 cut(s) 67, 85, 287, 355
BmsI GCATC 1 cut(s) 139
BpmI CTGGAG 2 cut(s) 30, 88
BpuEI CTTGAG 1 cut(s) 204
BpuMI CCSGG 1 cut(s) 355
BsaJI CCNNGG 2 cut(s) 84, 207
Bsc4I CCNNNNNNNGG 3 cut(s) 112, 173, 292
Bse1I ACTGG 3 cut(s) 170, 373, 404
BseBI CCWGG 3 cut(s) 67, 85, 287
BseDI CCNNGG 2 cut(s) 84, 207
BseGI GGATG 1 cut(s) 154
BseLI CCNNNNNNNGG 3 cut(s) 112, 173, 292
BseNI ACTGG 3 cut(s) 170, 373, 404
BshFI GGCC 1 cut(s) 372
BsiSI CCGG 1 cut(s) 354
BslI CCNNNNNNNGG 3 cut(s) 112, 173, 292
BsnI GGCC 1 cut(s) 372
Bsp19I CCATGG 1 cut(s) 207
BspACI CCGC 3 cut(s) 167, 293, 401
BspANI GGCC 1 cut(s) 372
BsrI ACTGG 3 cut(s) 170, 373, 404
BssECI CCNNGG 2 cut(s) 84, 207
BssT1I CCWWGG 1 cut(s) 207
Bst2UI CCWGG 3 cut(s) 67, 85, 287
BstC8I GCNNGC 3 cut(s) 303, 363, 374
BstDSI CCRYGG 1 cut(s) 207
BstF5I GGATG 1 cut(s) 154
BstMWI GCNNNNNNNGC 2 cut(s) 158, 302
BstNI CCWGG 3 cut(s) 67, 85, 287
BstNSI RCATGY 1 cut(s) 326
BstSCI CCNGG 4 cut(s) 65, 83, 285, 353
BstSFI CTRYAG 1 cut(s) 19
BsuRI GGCC 1 cut(s) 372
BtgI CCRYGG 1 cut(s) 207
BtgZI GCGATG 1 cut(s) 194
BtsCI GGATG 1 cut(s) 154
BtsIMutI CAGTG 2 cut(s) 152, 411
Cac8I GCNNGC 3 cut(s) 303, 363, 374
Csp6I GTAC 3 cut(s) 16, 45, 74
CviAII CATG 2 cut(s) 208, 323
CviJI RGCY 6 cut(s) 120, 161, 190, 305, 365, 372
CviKI_1 RGCY 6 cut(s) 120, 161, 190, 305, 365, 372
CviQI GTAC 3 cut(s) 16, 45, 74
Eco130I CCWWGG 1 cut(s) 207
Eco57I CTGAAG 2 cut(s) 176, 398
EcoRII CCWGG 3 cut(s) 65, 83, 285
EcoT14I CCWWGG 1 cut(s) 207
ErhI CCWWGG 1 cut(s) 207
FaeI CATG 2 cut(s) 211, 326
FaiI YATR 7 cut(s) 21, 108, 164, 209, 315, 324, 412
FalI AAGNNNNNCTT 2 cut(s) 290, 322
FatI CATG 2 cut(s) 207, 322
Fnu4HI GCNGC 3 cut(s) 167, 294, 401
FokI GGATG 1 cut(s) 161
Fsp4HI GCNGC 3 cut(s) 167, 294, 401
FspBI CTAG 4 cut(s) 26, 237, 255, 272
GluI GCNGC 3 cut(s) 167, 294, 401
GsuI CTGGAG 2 cut(s) 30, 88
HaeIII GGCC 1 cut(s) 372
HapII CCGG 1 cut(s) 354
Hin1II CATG 2 cut(s) 211, 326
HinfI GANTC 2 cut(s) 224, 268
HpaII CCGG 1 cut(s) 354
Hpy188I TCNGA 2 cut(s) 40, 348
Hpy188III TCNNGA 2 cut(s) 9, 221
HpyAV CCTTC 2 cut(s) 35, 151
HpyCH4V TGCA 3 cut(s) 152, 263, 361
HpyF10VI GCNNNNNNNGC 2 cut(s) 158, 302
Hsp92II CATG 2 cut(s) 211, 326
LweI GCATC 1 cut(s) 139
MaeI CTAG 4 cut(s) 26, 237, 255, 272
MboII GAAGA 1 cut(s) 391
MnlI CCTC 3 cut(s) 5, 63, 109
MseI TTAA 1 cut(s) 249
MslI CAYNNNNRTG 1 cut(s) 395
MspI CCGG 1 cut(s) 354
MspR9I CCNGG 4 cut(s) 67, 85, 287, 355
MvaI CCWGG 3 cut(s) 67, 85, 287
MwoI GCNNNNNNNGC 2 cut(s) 158, 302
NciI CCSGG 1 cut(s) 355
NcoI CCATGG 1 cut(s) 207
NlaIII CATG 2 cut(s) 211, 326
NspI RCATGY 1 cut(s) 326
OliI CACNNNNGTG 1 cut(s) 395
PfeI GAWTC 2 cut(s) 224, 268
PflMI CCANNNNNTGG 1 cut(s) 112
PkrI GCNGC 3 cut(s) 168, 295, 402
PsiI TTATAA 1 cut(s) 412
Psp6I CCWGG 3 cut(s) 65, 83, 285
PspGI CCWGG 3 cut(s) 65, 83, 285
RsaI GTAC 3 cut(s) 17, 46, 75
RsaNI GTAC 3 cut(s) 16, 45, 74
RseI CAYNNNNRTG 1 cut(s) 395
SaqAI TTAA 1 cut(s) 249
SatI GCNGC 3 cut(s) 167, 294, 401
ScrFI CCNGG 4 cut(s) 67, 85, 287, 355
SetI ASST 7 cut(s) 46, 68, 178, 242, 277, 367, 397
SfaNI GCATC 1 cut(s) 139
SfcI CTRYAG 1 cut(s) 19
SmiMI CAYNNNNRTG 1 cut(s) 395
SmlI CTYRAG 1 cut(s) 219
SmoI CTYRAG 1 cut(s) 219
SsiI CCGC 3 cut(s) 167, 293, 401
SspMI CTAG 4 cut(s) 26, 237, 255, 272
StyD4I CCNGG 4 cut(s) 65, 83, 285, 353
StyI CCWWGG 1 cut(s) 207
TauI GCSGC 3 cut(s) 169, 296, 403
TfiI GAWTC 2 cut(s) 224, 268
Tru1I TTAA 1 cut(s) 249
Tru9I TTAA 1 cut(s) 249
TscAI CASTG 2 cut(s) 159, 411
TspDTI ATGAA 1 cut(s) 45
TspRI CASTG 2 cut(s) 159, 411
Van91I CCANNNNNTGG 1 cut(s) 112
XceI RCATGY 1 cut(s) 326
XspI CTAG 4 cut(s) 26, 237, 255, 272
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.