MD05G1266400.v1.1

Belongs to the oxygen-dependent FAD-linked oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0005954
Physical Location & Seq
Forward (+)
40136623 .. 40137501
879 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1266400.v1.1.491

Sequence Viewer

Length: 879 bp
ATGAAGATTAGAAGTGGAGGCCATGATTTTGAGGGTTTATCATACGTGGCTGAATTTCCATTCTTCATCCTTTACATGTTTAATCTTCGATCCATCCACGTAGACATCAAATCCGAGACTGCATGGGTCCAGGCTGGGGCTACTCTTGGTGAACTTTACTACAGAATTGCTGAGAAAAGCAAAATCCATGGCTTTCCTGCTGGTGTTTGCCCTACAGTTGGTGTTGGAGGCCACTTCAGTGGCGGTGGATATGGTAATATGATGGGAAAGTACGGCTTGTCAGTTGACAACATAGTTGATGCACAACTTGTAAATGTGAATGGTGAACTTCTCGACCGAAAATCAATGGGAGAAGACCTTTTTTGGGCCATTACAGGAGGCGGAGGAGCCAGCTTTGGAGTTGTGATCGCGTACAAACTTAATCATGTACGTGTTCCAGAAACAGTTACTGTTTTAAAGGTTCCGAGAACCCTAGAACAAAATGCAACGGACATTGTCTATCGTTGGCAATATATCGCGGATAAGCTTGACAATGACTTGTTCATCAGGCTTATCATGGATATTGTAAATGGTACTACTTCAAATAGTAGTGGAGAAAACAATAAGACTCTTAGGGCTTCATTTATTGCCATGTTTCTCGGAGACTCTGAGAGGCTCCTCTCAATCATGGACAAGAGCTTCCCTGAATTGGGTATGAAGCAATCTGATTGCAATGAAATGAGCTGGGCTCAATCTGTGCTTTTCTGGACGAGCTTCCCAACCGGGACAGCAACTGAAGCTTTGCTTTCAAGAACACCTCAAGTGCTTACACACTTCAAGAGAAAGTCAGACTATGTCAAAAAACCAATTCCAAAAACTGGTTTGAAGTGGATTTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BBE FAD_binding_4

Protein Analysis

293

Amino Acids

32.43

Weight (kDa)

7.75

Isoelectric Point (pI)

25.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FAD_binding_4 PF01565 3 - 111 1e-17 FAD binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 857
AccI GTMKAC 1 cut(s) 102
AccII CGCG 2 cut(s) 410, 518
AciI CCGC 3 cut(s) 243, 381, 518
AclWI GGATC 1 cut(s) 84
AcsI RAATTY 1 cut(s) 53
AcuI CTGAAG 2 cut(s) 220, 795
AfaI GTAC 4 cut(s) 272, 413, 429, 574
AfiI CCNNNNNNNGG 6 cut(s) 136, 218, 364, 688, 689, 857
AflIII ACRYGT 2 cut(s) 75, 430
AgsI TTSAA 4 cut(s) 582, 789, 817, 865
AjnI CCWGG 1 cut(s) 129
AleI CACNNNNGTG 1 cut(s) 237
AluBI AGCT 6 cut(s) 393, 526, 678, 723, 753, 779
AluI AGCT 6 cut(s) 393, 526, 678, 723, 753, 779
Alw26I GTCTC 2 cut(s) 110, 636
AlwI GGATC 1 cut(s) 84
AlwNI CAGNNNCTG 2 cut(s) 449, 773
AoxI GGCC 3 cut(s) 19, 229, 366
ApoI RAATTY 1 cut(s) 53
AspS9I GGNCC 2 cut(s) 127, 366
AsuC2I CCSGG 1 cut(s) 763
AsuHPI GGTGA 2 cut(s) 161, 335
AvaII GGWCC 1 cut(s) 127
BanII GRGCYC 1 cut(s) 730
BbsI GAAGAC 1 cut(s) 360
BccI CCATC 2 cut(s) 101, 256
BceAI ACGGC 1 cut(s) 289
BciT130I CCWGG 1 cut(s) 131
BcnI CCSGG 1 cut(s) 763
BcoDI GTCTC 2 cut(s) 110, 636
BfaI CTAG 1 cut(s) 473
BfmI CTRYAG 2 cut(s) 160, 213
Bme1390I CCNGG 2 cut(s) 131, 763
Bme18I GGWCC 1 cut(s) 127
BmgT120I GGNCC 2 cut(s) 127, 366
BmiI GGNNCC 4 cut(s) 128, 388, 462, 656
BmrFI CCNGG 2 cut(s) 131, 763
BmsI GCATC 1 cut(s) 289
BpiI GAAGAC 1 cut(s) 360
BplI GAGNNNNNCTC 2 cut(s) 712, 744
BpuEI CTTGAG 1 cut(s) 783
BpuMI CCSGG 1 cut(s) 763
BsaAI YACGTR 3 cut(s) 46, 100, 431
BsaJI CCNNGG 1 cut(s) 187
Bsc4I CCNNNNNNNGG 6 cut(s) 136, 218, 364, 688, 689, 857
Bse1I ACTGG 1 cut(s) 862
Bse3DI GCAATG 1 cut(s) 718
BseBI CCWGG 1 cut(s) 131
BseDI CCNNGG 1 cut(s) 187
BseGI GGATG 2 cut(s) 66, 93
BseLI CCNNNNNNNGG 6 cut(s) 136, 218, 364, 688, 689, 857
BseMI GCAATG 1 cut(s) 718
BseMII CTCAG 2 cut(s) 162, 639
BseNI ACTGG 1 cut(s) 862
BseRI GAGGAG 2 cut(s) 399, 647
BseYI CCCAGC 2 cut(s) 134, 723
Bsh1236I CGCG 2 cut(s) 410, 518
Bsh1285I CGRYCG 1 cut(s) 337
BshFI GGCC 3 cut(s) 21, 231, 368
BsiEI CGRYCG 1 cut(s) 337
BsiSI CCGG 1 cut(s) 762
BslFI GGGAC 1 cut(s) 778
BslI CCNNNNNNNGG 6 cut(s) 136, 218, 364, 688, 689, 857
BsmAI GTCTC 2 cut(s) 110, 636
BsmFI GGGAC 1 cut(s) 778
BsnI GGCC 3 cut(s) 21, 231, 368
Bsp1286I GDGCHC 1 cut(s) 730
Bsp143I GATC 2 cut(s) 89, 405
Bsp19I CCATGG 1 cut(s) 187
BspACI CCGC 3 cut(s) 243, 381, 518
BspANI GGCC 3 cut(s) 21, 231, 368
BspCNI CTCAG 2 cut(s) 163, 640
BspFNI CGCG 2 cut(s) 410, 518
BspLI GGNNCC 4 cut(s) 128, 388, 462, 656
BspPI GGATC 1 cut(s) 84
BsrDI GCAATG 1 cut(s) 718
BsrI ACTGG 1 cut(s) 862
BssECI CCNNGG 1 cut(s) 187
BssMI GATC 2 cut(s) 89, 405
BssT1I CCWWGG 1 cut(s) 187
Bst2UI CCWGG 1 cut(s) 131
Bst4CI ACNGT 3 cut(s) 217, 445, 451
BstBAI YACGTR 3 cut(s) 46, 100, 431
BstC8I GCNNGC 1 cut(s) 391
BstDEI CTNAG 3 cut(s) 171, 611, 648
BstDSI CCRYGG 1 cut(s) 187
BstF5I GGATG 2 cut(s) 66, 93
BstFNI CGCG 2 cut(s) 410, 518
BstKTI GATC 2 cut(s) 92, 408
BstMAI GTCTC 2 cut(s) 110, 636
BstMBI GATC 2 cut(s) 89, 405
BstMCI CGRYCG 1 cut(s) 337
BstMWI GCNNNNNNNGC 1 cut(s) 776
BstNI CCWGG 1 cut(s) 131
BstNSI RCATGY 1 cut(s) 79
BstSCI CCNGG 2 cut(s) 129, 761
BstSFI CTRYAG 2 cut(s) 160, 213
BstUI CGCG 2 cut(s) 410, 518
BstV2I GAAGAC 1 cut(s) 360
BstXI CCANNNNNNTGG 1 cut(s) 239
BsuRI GGCC 3 cut(s) 21, 231, 368
BtgI CCRYGG 1 cut(s) 187
BtsCI GGATG 2 cut(s) 66, 93
BtsIMutI CAGTG 1 cut(s) 244
Cac8I GCNNGC 1 cut(s) 391
CaiI CAGNNNCTG 2 cut(s) 449, 773
Cfr13I GGNCC 2 cut(s) 127, 366
Csp6I GTAC 4 cut(s) 271, 412, 428, 573
CviAII CATG 8 cut(s) 23, 76, 123, 188, 425, 556, 631, 667
CviQI GTAC 4 cut(s) 271, 412, 428, 573
DdeI CTNAG 3 cut(s) 171, 611, 648
DpnI GATC 2 cut(s) 91, 407
DpnII GATC 2 cut(s) 89, 405
DraI TTTAAA 1 cut(s) 456
EciI GGCGGA 1 cut(s) 396
Eco130I CCWWGG 1 cut(s) 187
Eco24I GRGCYC 1 cut(s) 730
Eco47I GGWCC 1 cut(s) 127
Eco57I CTGAAG 2 cut(s) 220, 795
EcoRII CCWGG 1 cut(s) 129
EcoT14I CCWWGG 1 cut(s) 187
EcoT38I GRGCYC 1 cut(s) 730
ErhI CCWWGG 1 cut(s) 187
FaeI CATG 8 cut(s) 26, 79, 126, 191, 428, 559, 634, 670
FalI AAGNNNNNCTT 4 cut(s) 260, 292, 768, 800
FaqI GGGAC 1 cut(s) 778
FatI CATG 8 cut(s) 22, 75, 122, 187, 424, 555, 630, 666
FblI GTMKAC 1 cut(s) 102
FokI GGATG 2 cut(s) 53, 80
FriOI GRGCYC 1 cut(s) 730
FspBI CTAG 1 cut(s) 473
GsaI CCCAGC 2 cut(s) 138, 727
HaeIII GGCC 3 cut(s) 21, 231, 368
HapII CCGG 1 cut(s) 762
Hin1II CATG 8 cut(s) 26, 79, 126, 191, 428, 559, 634, 670
HincII GTYRAC 1 cut(s) 286
HindII GTYRAC 1 cut(s) 286
HindIII AAGCTT 2 cut(s) 524, 777
HinfI GANTC 2 cut(s) 607, 644
HpaII CCGG 1 cut(s) 762
HphI GGTGA 2 cut(s) 161, 335
Hpy166II GTNNAC 4 cut(s) 103, 152, 286, 326
Hpy188I TCNGA 6 cut(s) 115, 465, 641, 649, 706, 829
Hpy188III TCNNGA 5 cut(s) 332, 437, 745, 789, 817
Hpy8I GTNNAC 4 cut(s) 103, 152, 286, 326
HpyCH4III ACNGT 3 cut(s) 217, 445, 451
HpyCH4IV ACGT 3 cut(s) 45, 99, 430
HpyCH4V TGCA 4 cut(s) 122, 302, 485, 711
HpyF10VI GCNNNNNNNGC 1 cut(s) 776
HpyF3I CTNAG 3 cut(s) 171, 611, 648
HpySE526I ACGT 3 cut(s) 45, 99, 430
Hsp92II CATG 8 cut(s) 26, 79, 126, 191, 428, 559, 634, 670
Kzo9I GATC 2 cut(s) 89, 405
LmnI GCTCC 2 cut(s) 386, 660
LweI GCATC 1 cut(s) 289
MaeI CTAG 1 cut(s) 473
MaeII ACGT 3 cut(s) 45, 99, 430
MaeIII GTNAC 1 cut(s) 445
MalI GATC 2 cut(s) 91, 407
MboI GATC 2 cut(s) 89, 405
MboII GAAGA 4 cut(s) 16, 55, 77, 365
MhlI GDGCHC 1 cut(s) 730
MluCI AATT 4 cut(s) 53, 165, 686, 846
MlyI GAGTC 2 cut(s) 601, 638
MmeI TCCRAC 1 cut(s) 205
MnlI CCTC 8 cut(s) 11, 25, 221, 371, 377, 645, 668, 807
MseI TTAA 3 cut(s) 81, 420, 455
MslI CAYNNNNRTG 2 cut(s) 237, 429
MspI CCGG 1 cut(s) 762
MspR9I CCNGG 2 cut(s) 131, 763
MvaI CCWGG 1 cut(s) 131
MvnI CGCG 2 cut(s) 410, 518
MwoI GCNNNNNNNGC 1 cut(s) 776
NciI CCSGG 1 cut(s) 763
NcoI CCATGG 1 cut(s) 187
NdeII GATC 2 cut(s) 89, 405
NlaIII CATG 8 cut(s) 26, 79, 126, 191, 428, 559, 634, 670
NlaIV GGNNCC 4 cut(s) 128, 388, 462, 656
NspI RCATGY 1 cut(s) 79
OliI CACNNNNGTG 1 cut(s) 237
PciI ACATGT 1 cut(s) 75
PflFI GACNNNGTC 2 cut(s) 494, 833
PflMI CCANNNNNTGG 1 cut(s) 857
PleI GAGTC 2 cut(s) 601, 638
PpsI GAGTC 2 cut(s) 601, 638
Ppu21I YACGTR 3 cut(s) 46, 100, 431
PscI ACATGT 1 cut(s) 75
Psp6I CCWGG 1 cut(s) 129
PspFI CCCAGC 2 cut(s) 134, 723
PspGI CCWGG 1 cut(s) 129
PspN4I GGNNCC 4 cut(s) 128, 388, 462, 656
PspPI GGNCC 2 cut(s) 127, 366
PstNI CAGNNNCTG 2 cut(s) 449, 773
PsyI GACNNNGTC 2 cut(s) 494, 833
RsaI GTAC 4 cut(s) 272, 413, 429, 574
RsaNI GTAC 4 cut(s) 271, 412, 428, 573
RseI CAYNNNNRTG 2 cut(s) 237, 429
SaqAI TTAA 3 cut(s) 81, 420, 455
Sau3AI GATC 2 cut(s) 89, 405
Sau96I GGNCC 2 cut(s) 127, 366
SchI GAGTC 2 cut(s) 601, 638
ScrFI CCNGG 2 cut(s) 131, 763
SduI GDGCHC 1 cut(s) 730
SfaNI GCATC 1 cut(s) 289
SfcI CTRYAG 2 cut(s) 160, 213
SinI GGWCC 1 cut(s) 127
SmiMI CAYNNNNRTG 2 cut(s) 237, 429
SmlI CTYRAG 1 cut(s) 798
SmoI CTYRAG 1 cut(s) 798
Sse9I AATT 4 cut(s) 53, 165, 686, 846
SsiI CCGC 3 cut(s) 243, 381, 518
SspMI CTAG 1 cut(s) 473
StyD4I CCNGG 2 cut(s) 129, 761
StyI CCWWGG 1 cut(s) 187
TaaI ACNGT 3 cut(s) 217, 445, 451
TaiI ACGT 3 cut(s) 48, 102, 433
TaqI TCGA 2 cut(s) 88, 333
TaqII GACCGA 1 cut(s) 351
TasI AATT 4 cut(s) 53, 165, 686, 846
Tru1I TTAA 3 cut(s) 81, 420, 455
Tru9I TTAA 3 cut(s) 81, 420, 455
TscAI CASTG 1 cut(s) 244
TspDTI ATGAA 6 cut(s) 17, 55, 532, 609, 710, 729
TspGWI ACGGA 1 cut(s) 503
TspRI CASTG 1 cut(s) 244
Tth111I GACNNNGTC 2 cut(s) 494, 833
Van91I CCANNNNNTGG 1 cut(s) 857
VpaK11BI GGWCC 1 cut(s) 127
XapI RAATTY 1 cut(s) 53
XceI RCATGY 1 cut(s) 79
XmiI GTMKAC 1 cut(s) 102
XspI CTAG 1 cut(s) 473
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.