MD07G1304800.v1.1

Agenet domain

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Forward (+)
36204325 .. 36206926
2602 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1304800.v1.1.491

Sequence Viewer

Length: 357 bp
ATGGAAGTGGTCGATGCAAAGCAAATAAGGCCTTATCCTCCAAACCTAGTTTTGGCTGAAAGTTTCAGTGTAACACAAGAGGTTGATGTTTTCTATAATGGTTGCTGGTGGGAAGGTGTGATCCGCAACGTCCTTCACGGGCAAAGGTACAAAGTTTACATCAAAGGTACAAATGATGAACTGCTGTTTCAGCACTCTGATTTGAGGCCACGCCAAGATTGGATAGATGGAACATGGTTCATTGCTTCTCAGGCACCCAAAGTATATGCCGTCAAATATCACTACAAATCAAAGTATATGCAGGCACCCAAAATATATGTATATAAATATATATACATATATTTTTATCTCGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

119

Amino Acids

14.2

Weight (kDa)

8.87

Isoelectric Point (pI)

32.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 253, 304
AciI CCGC 1 cut(s) 124
AclWI GGATC 1 cut(s) 115
AfaI GTAC 2 cut(s) 149, 169
AfiI CCNNNNNNNGG 1 cut(s) 52
AlwI GGATC 1 cut(s) 115
AoxI GGCC 2 cut(s) 29, 206
BanI GGYRCC 2 cut(s) 253, 304
BccI CCATC 1 cut(s) 221
BceAI ACGGC 1 cut(s) 254
BfaI CTAG 1 cut(s) 47
BmiI GGNNCC 2 cut(s) 255, 306
BmsI GCATC 1 cut(s) 4
Bsc4I CCNNNNNNNGG 1 cut(s) 52
Bse3DI GCAATG 1 cut(s) 240
BseLI CCNNNNNNNGG 1 cut(s) 52
BseMI GCAATG 1 cut(s) 240
BseMII CTCAG 1 cut(s) 263
BshFI GGCC 2 cut(s) 31, 208
BshNI GGYRCC 2 cut(s) 253, 304
BslI CCNNNNNNNGG 1 cut(s) 52
BsnI GGCC 2 cut(s) 31, 208
Bsp143I GATC 1 cut(s) 120
BspACI CCGC 1 cut(s) 124
BspANI GGCC 2 cut(s) 31, 208
BspCNI CTCAG 1 cut(s) 262
BspLI GGNNCC 2 cut(s) 255, 306
BspPI GGATC 1 cut(s) 115
BspT107I GGYRCC 2 cut(s) 253, 304
BsrDI GCAATG 1 cut(s) 240
BssMI GATC 1 cut(s) 120
BstC8I GCNNGC 1 cut(s) 303
BstDEI CTNAG 1 cut(s) 249
BstKTI GATC 1 cut(s) 123
BstMBI GATC 1 cut(s) 120
BstMWI GCNNNNNNNGC 3 cut(s) 28, 190, 251
BsuRI GGCC 2 cut(s) 31, 208
BtsIMutI CAGTG 1 cut(s) 73
Cac8I GCNNGC 1 cut(s) 303
Csp6I GTAC 2 cut(s) 148, 168
CviAII CATG 1 cut(s) 234
CviJI RGCY 3 cut(s) 31, 56, 208
CviKI_1 RGCY 3 cut(s) 31, 56, 208
CviQI GTAC 2 cut(s) 148, 168
DdeI CTNAG 1 cut(s) 249
DpnI GATC 1 cut(s) 122
DpnII GATC 1 cut(s) 120
Eco147I AGGCCT 1 cut(s) 31
FaeI CATG 1 cut(s) 237
FatI CATG 1 cut(s) 233
FspBI CTAG 1 cut(s) 47
HaeIII GGCC 2 cut(s) 31, 208
Hin1II CATG 1 cut(s) 237
Hpy166II GTNNAC 1 cut(s) 157
Hpy188I TCNGA 1 cut(s) 199
Hpy8I GTNNAC 1 cut(s) 157
HpyAV CCTTC 2 cut(s) 107, 143
HpyCH4IV ACGT 1 cut(s) 129
HpyCH4V TGCA 2 cut(s) 17, 301
HpyF10VI GCNNNNNNNGC 3 cut(s) 28, 190, 251
HpyF3I CTNAG 1 cut(s) 249
HpySE526I ACGT 1 cut(s) 129
Hsp92II CATG 1 cut(s) 237
Kzo9I GATC 1 cut(s) 120
LpnPI CCDG 3 cut(s) 91, 236, 287
LweI GCATC 1 cut(s) 4
MaeI CTAG 1 cut(s) 47
MaeII ACGT 1 cut(s) 129
MaeIII GTNAC 1 cut(s) 70
MalI GATC 1 cut(s) 122
MboI GATC 1 cut(s) 120
MnlI CCTC 3 cut(s) 48, 73, 198
MseI TTAA 1 cut(s) 355
MwoI GCNNNNNNNGC 3 cut(s) 28, 190, 251
NdeII GATC 1 cut(s) 120
NlaIII CATG 1 cut(s) 237
NlaIV GGNNCC 2 cut(s) 255, 306
PceI AGGCCT 1 cut(s) 31
PspN4I GGNNCC 2 cut(s) 255, 306
RsaI GTAC 2 cut(s) 149, 169
RsaNI GTAC 2 cut(s) 148, 168
SaqAI TTAA 1 cut(s) 355
Sau3AI GATC 1 cut(s) 120
SetI ASST 6 cut(s) 48, 84, 118, 132, 149, 169
SfaNI GCATC 1 cut(s) 4
SseBI AGGCCT 1 cut(s) 31
SsiI CCGC 1 cut(s) 124
SspMI CTAG 1 cut(s) 47
StuI AGGCCT 1 cut(s) 31
TaiI ACGT 1 cut(s) 132
TaqI TCGA 1 cut(s) 12
Tru1I TTAA 1 cut(s) 355
Tru9I TTAA 1 cut(s) 355
TscAI CASTG 1 cut(s) 73
TspDTI ATGAA 2 cut(s) 192, 229
TspRI CASTG 1 cut(s) 73
XcmI CCANNNNNNNNNTGG 1 cut(s) 216
XspI CTAG 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.