pycom07g27770

Agenet domain

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Forward (+)
27352445 .. 27352753
309 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g27770.1

Sequence Viewer

Length: 309 bp
ATGAGATTCTCATGCAAGACAATAAGAACAGATGACAATAAGGAGTTCCTAATGGAAGTGGTCGATGCAAAGCAAATAAGGCCTTATCCTCCAAACCTAGTTCTGGCTGAAAGTTTCAGTGTAACACAAGAGGTTGATGTTTTCTATAATGGTTGCTGGTGGGAAGGTGTGATCCGCAACGTCCTTCACGGGCGAAGGTACAAAGTTTACATCAAAGGTACAAATGATGAACTGCTGCTTCAGCACTCTGATTTGAGGCCACGCCAAGATTGGATAGATGGAACATTGTTTATTGCTTCTCAGGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

12.02

Weight (kDa)

6.07

Isoelectric Point (pI)

35.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 175
AclWI GGATC 1 cut(s) 166
AcuI CTGAAG 1 cut(s) 224
AfaI GTAC 2 cut(s) 200, 220
AfiI CCNNNNNNNGG 1 cut(s) 103
AlwI GGATC 1 cut(s) 166
AoxI GGCC 2 cut(s) 80, 257
ApeKI GCWGC 1 cut(s) 235
BbvI GCAGC 1 cut(s) 222
BccI CCATC 1 cut(s) 272
BfaI CTAG 1 cut(s) 98
BisI GCNGC 1 cut(s) 236
BlsI GCNGC 1 cut(s) 237
BmsI GCATC 1 cut(s) 55
Bsc4I CCNNNNNNNGG 1 cut(s) 103
BseLI CCNNNNNNNGG 1 cut(s) 103
BseXI GCAGC 1 cut(s) 222
BshFI GGCC 2 cut(s) 82, 259
BslI CCNNNNNNNGG 1 cut(s) 103
BsnI GGCC 2 cut(s) 82, 259
Bsp143I GATC 1 cut(s) 171
BspACI CCGC 1 cut(s) 175
BspANI GGCC 2 cut(s) 82, 259
BspPI GGATC 1 cut(s) 166
BssMI GATC 1 cut(s) 171
BstDEI CTNAG 1 cut(s) 300
BstKTI GATC 1 cut(s) 174
BstMBI GATC 1 cut(s) 171
BstMWI GCNNNNNNNGC 2 cut(s) 79, 241
BstV1I GCAGC 1 cut(s) 222
BsuRI GGCC 2 cut(s) 82, 259
BtsIMutI CAGTG 1 cut(s) 124
Csp6I GTAC 2 cut(s) 199, 219
CviAII CATG 1 cut(s) 12
CviJI RGCY 3 cut(s) 82, 107, 259
CviKI_1 RGCY 3 cut(s) 82, 107, 259
CviQI GTAC 2 cut(s) 199, 219
DdeI CTNAG 1 cut(s) 300
DpnI GATC 1 cut(s) 173
DpnII GATC 1 cut(s) 171
Eco147I AGGCCT 1 cut(s) 82
Eco57I CTGAAG 1 cut(s) 224
FaeI CATG 1 cut(s) 15
FaiI YATR 3 cut(s) 13, 147, 307
FatI CATG 1 cut(s) 11
Fnu4HI GCNGC 1 cut(s) 236
Fsp4HI GCNGC 1 cut(s) 236
FspBI CTAG 1 cut(s) 98
GluI GCNGC 1 cut(s) 236
HaeIII GGCC 2 cut(s) 82, 259
Hin1II CATG 1 cut(s) 15
HinfI GANTC 1 cut(s) 6
Hpy166II GTNNAC 1 cut(s) 208
Hpy188I TCNGA 1 cut(s) 250
Hpy8I GTNNAC 1 cut(s) 208
HpyAV CCTTC 3 cut(s) 158, 189, 194
HpyCH4IV ACGT 1 cut(s) 180
HpyCH4V TGCA 2 cut(s) 15, 68
HpyF10VI GCNNNNNNNGC 2 cut(s) 79, 241
HpyF3I CTNAG 1 cut(s) 300
HpySE526I ACGT 1 cut(s) 180
Hsp92II CATG 1 cut(s) 15
Kzo9I GATC 1 cut(s) 171
LpnPI CCDG 3 cut(s) 89, 142, 287
Lsp1109I GCAGC 1 cut(s) 222
LweI GCATC 1 cut(s) 55
MaeI CTAG 1 cut(s) 98
MaeII ACGT 1 cut(s) 180
MaeIII GTNAC 1 cut(s) 121
MalI GATC 1 cut(s) 173
MboI GATC 1 cut(s) 171
MnlI CCTC 3 cut(s) 99, 124, 249
MwoI GCNNNNNNNGC 2 cut(s) 79, 241
NdeII GATC 1 cut(s) 171
NlaIII CATG 1 cut(s) 15
PceI AGGCCT 1 cut(s) 82
PfeI GAWTC 1 cut(s) 6
PkrI GCNGC 1 cut(s) 237
RsaI GTAC 2 cut(s) 200, 220
RsaNI GTAC 2 cut(s) 199, 219
SatI GCNGC 1 cut(s) 236
Sau3AI GATC 1 cut(s) 171
SetI ASST 7 cut(s) 99, 135, 169, 183, 200, 220, 306
SfaNI GCATC 1 cut(s) 55
SseBI AGGCCT 1 cut(s) 82
SsiI CCGC 1 cut(s) 175
SspMI CTAG 1 cut(s) 98
StuI AGGCCT 1 cut(s) 82
TaiI ACGT 1 cut(s) 183
TaqI TCGA 1 cut(s) 63
TfiI GAWTC 1 cut(s) 6
TscAI CASTG 1 cut(s) 124
TseI GCWGC 1 cut(s) 235
TspDTI ATGAA 1 cut(s) 243
TspRI CASTG 1 cut(s) 124
XcmI CCANNNNNNNNNTGG 1 cut(s) 267
XspI CTAG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.