Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr08

Orthogroup ID

OG0004663

Physical Location & Seq

Genomic Coordinates Forward (+)

13007275 .. 13010383

Gene Structure 3109 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD08G1136600.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 249 bp

ATGGATATGGAATATCTTGGGATGTCATTTCCCGGTATATCTGATCAGTCCCTTAGTGATGTGTATTTGGCAAATAGGGGCGACCTGGATGCCACCATTGACATGCTGAACCAACTTGAGTTTGAATCTTCTGAAAGTCTTCCAGACACTTTGGACATTGGAGATGTTTCTGAATCTGGGTTGGTGGGCAATAGTGCATGGAAGCTGAAGAATGTAGCAGGTGAAGCCAGCAGTTCGCCCAAATCGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CUE

Protein Analysis

83

Amino Acids

8.75

Weight (kDa)

4.05

Isoelectric Point (pI)

37.72

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004663)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G11440 AT5G11440 AT5G25540 AT5G25540 AT5G25540
fragaria_vesca	FvH4_2g30160 FvH4_2g30160 FvH4_2g30160 FvH4_2g30160 FvH4_2g30160
malus_domestica	MD08G1136600.v1.1
prunus_persica	Prupe.1G466700_v2.0.a1 Prupe.1G466700_v2.0.a1 Prupe.1G466700_v2.0.a1 Prupe.1G466700_v2.0.a1
pyrus_communis	pycom08g11540 pycom15g10400 pycom15g10410
rosa_chinensis	RchiOBHm_Chr6g0312751
rosa_laevigata	RLG00000010301
rosa_multiflora	Rmu_ssc0000412.1_g000014
rosa_roxburghii	Rroxscaffold_7G00156530
rosa_rugosa	Rorug06G0399200 Rorug06G0399300 Rorug06G0399400 Rorug06G0399500
rosa_samantha	Rh6AG516300 Rh6BG527600 Rh6CG532500 Rh6DG518600
rosa_wichuraiana	Rw6G044860

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	209
Acc36I	ACCTGC	1 cut(s)	209
AcuI	CTGAAG	1 cut(s)	227
AgsI	TTSAA	1 cut(s)	125
AjnI	CCWGG	1 cut(s)	84
AluBI	AGCT	1 cut(s)	205
AluI	AGCT	1 cut(s)	205
Asp700I	GAANNNNTTC	1 cut(s)	138
AsuC2I	CCSGG	1 cut(s)	33
AsuHPI	GGTGA	1 cut(s)	233
BbsI	GAAGAC	1 cut(s)	131
BcgI	CGANNNNNNTGC	2 cut(s)	71, 105
BciT130I	CCWGG	1 cut(s)	86
BclI	TGATCA	1 cut(s)	43
BcnI	CCSGG	1 cut(s)	33
BfuAI	ACCTGC	1 cut(s)	209
Bme1390I	CCNGG	2 cut(s)	33, 86
BmrFI	CCNGG	2 cut(s)	33, 86
BmsI	GCATC	1 cut(s)	79
BpiI	GAAGAC	1 cut(s)	131
BpuEI	CTTGAG	1 cut(s)	137
BpuMI	CCSGG	1 cut(s)	33
BseBI	CCWGG	1 cut(s)	86
BseGI	GGATG	2 cut(s)	27, 94
BsiSI	CCGG	1 cut(s)	33
BslFI	GGGAC	1 cut(s)	34
BsmFI	GGGAC	1 cut(s)	34
Bsp143I	GATC	1 cut(s)	43
BspMI	ACCTGC	1 cut(s)	209
BssMI	GATC	1 cut(s)	43
Bst2UI	CCWGG	1 cut(s)	86
BstC8I	GCNNGC	1 cut(s)	229
BstDEI	CTNAG	1 cut(s)	53
BstF5I	GGATG	2 cut(s)	27, 94
BstKTI	GATC	1 cut(s)	46
BstMBI	GATC	1 cut(s)	43
BstMWI	GCNNNNNNNGC	1 cut(s)	224
BstNI	CCWGG	1 cut(s)	86
BstNSI	RCATGY	1 cut(s)	106
BstSCI	CCNGG	2 cut(s)	31, 84
BstV2I	GAAGAC	1 cut(s)	131
BtsCI	GGATG	2 cut(s)	27, 94
BveI	ACCTGC	1 cut(s)	209
Cac8I	GCNNGC	1 cut(s)	229
CviAII	CATG	2 cut(s)	103, 198
CviJI	RGCY	2 cut(s)	205, 227
CviKI_1	RGCY	2 cut(s)	205, 227
DdeI	CTNAG	1 cut(s)	53
DpnI	GATC	1 cut(s)	45
DpnII	GATC	1 cut(s)	43
Eco57I	CTGAAG	1 cut(s)	227
EcoRII	CCWGG	1 cut(s)	84
FaeI	CATG	2 cut(s)	106, 201
FaiI	YATR	4 cut(s)	8, 38, 104, 199
FaqI	GGGAC	1 cut(s)	34
FatI	CATG	2 cut(s)	102, 197
FbaI	TGATCA	1 cut(s)	43
FokI	GGATG	2 cut(s)	34, 101
HapII	CCGG	1 cut(s)	33
Hin1II	CATG	2 cut(s)	106, 201
HinfI	GANTC	2 cut(s)	125, 173
HpaII	CCGG	1 cut(s)	33
HphI	GGTGA	1 cut(s)	233
Hpy188I	TCNGA	3 cut(s)	43, 133, 172
Hpy188III	TCNNGA	1 cut(s)	143
HpyCH4V	TGCA	1 cut(s)	197
HpyF10VI	GCNNNNNNNGC	1 cut(s)	224
HpyF3I	CTNAG	1 cut(s)	53
Hsp92II	CATG	2 cut(s)	106, 201
Ksp22I	TGATCA	1 cut(s)	43
Kzo9I	GATC	1 cut(s)	43
LpnPI	CCDG	7 cut(s)	46, 71, 98, 156, 162, 204, 241
LweI	GCATC	1 cut(s)	79
MalI	GATC	1 cut(s)	45
MboI	GATC	1 cut(s)	43
MboII	GAAGA	3 cut(s)	120, 131, 220
MroXI	GAANNNNTTC	1 cut(s)	138
MslI	CAYNNNNRTG	1 cut(s)	101
MspI	CCGG	1 cut(s)	33
MspR9I	CCNGG	2 cut(s)	33, 86
MvaI	CCWGG	1 cut(s)	86
MwoI	GCNNNNNNNGC	1 cut(s)	224
NciI	CCSGG	1 cut(s)	33
NdeII	GATC	1 cut(s)	43
NlaIII	CATG	2 cut(s)	106, 201
NspI	RCATGY	1 cut(s)	106
PaqCI	CACCTGC	1 cut(s)	209
PcsI	WCGNNNNNNNCGW	1 cut(s)	242
PdmI	GAANNNNTTC	1 cut(s)	138
PfeI	GAWTC	2 cut(s)	125, 173
Psp6I	CCWGG	1 cut(s)	84
PspGI	CCWGG	1 cut(s)	84
RseI	CAYNNNNRTG	1 cut(s)	101
Sau3AI	GATC	1 cut(s)	43
ScrFI	CCNGG	2 cut(s)	33, 86
SetI	ASST	3 cut(s)	87, 207, 223
SfaNI	GCATC	1 cut(s)	79
SmiMI	CAYNNNNRTG	1 cut(s)	101
SmlI	CTYRAG	1 cut(s)	116
SmoI	CTYRAG	1 cut(s)	116
StyD4I	CCNGG	2 cut(s)	31, 84
TfiI	GAWTC	2 cut(s)	125, 173
XceI	RCATGY	1 cut(s)	106
XmnI	GAANNNNTTC	1 cut(s)	138

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.