pycom15g10400

Polyadenylate-binding protein-interacting protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
6886060 .. 6886420
361 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g10400.2

Sequence Viewer

Length: 234 bp
ATGAAGCCAGGACTTTCTTCTTTGAATCCCTACGCAGCAGCATACATTCCAATCTCCAAGAGGGAGACAGATGATAGAACTTTTGTGACAACGAAAGATTCTAGCCGCAGCAATGATCAGTCTGGTTTGGGAACCCTCAAAATTTTACCCAGAATCAACACCATAGCAAAGCTTATCTTCAATCTGATGCCCCAGGGACTGCAACACTCCAGAGTCCAAAGTCTTATGCTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.55

Weight (kDa)

10.11

Isoelectric Point (pI)

55.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 106
AcsI RAATTY 1 cut(s) 141
AgsI TTSAA 2 cut(s) 25, 181
AjnI CCWGG 2 cut(s) 7, 192
AluBI AGCT 1 cut(s) 172
AluI AGCT 1 cut(s) 172
Alw26I GTCTC 1 cut(s) 59
AlwNI CAGNNNCTG 1 cut(s) 199
ApeKI GCWGC 3 cut(s) 35, 38, 108
ApoI RAATTY 1 cut(s) 141
BbvI GCAGC 3 cut(s) 47, 50, 120
BciT130I CCWGG 2 cut(s) 9, 194
BclI TGATCA 1 cut(s) 115
BcoDI GTCTC 1 cut(s) 59
BfaI CTAG 1 cut(s) 102
BisI GCNGC 4 cut(s) 36, 39, 106, 109
BlsI GCNGC 4 cut(s) 37, 40, 107, 110
Bme1390I CCNGG 2 cut(s) 9, 194
BmiI GGNNCC 1 cut(s) 133
BmrFI CCNGG 2 cut(s) 9, 194
BmsI GCATC 1 cut(s) 177
BpmI CTGGAG 1 cut(s) 193
BsaJI CCNNGG 2 cut(s) 192, 193
Bse3DI GCAATG 1 cut(s) 118
BseBI CCWGG 2 cut(s) 9, 194
BseDI CCNNGG 2 cut(s) 192, 193
BseMI GCAATG 1 cut(s) 118
BseXI GCAGC 3 cut(s) 47, 50, 120
BslFI GGGAC 1 cut(s) 210
BsmAI GTCTC 1 cut(s) 59
BsmFI GGGAC 1 cut(s) 210
Bsp143I GATC 1 cut(s) 115
BspACI CCGC 1 cut(s) 106
BspLI GGNNCC 1 cut(s) 133
BsrDI GCAATG 1 cut(s) 118
BssECI CCNNGG 2 cut(s) 192, 193
BssMI GATC 1 cut(s) 115
Bst2UI CCWGG 2 cut(s) 9, 194
BstKTI GATC 1 cut(s) 118
BstMAI GTCTC 1 cut(s) 59
BstMBI GATC 1 cut(s) 115
BstNI CCWGG 2 cut(s) 9, 194
BstSCI CCNGG 2 cut(s) 7, 192
BstV1I GCAGC 3 cut(s) 47, 50, 120
CaiI CAGNNNCTG 1 cut(s) 199
CviJI RGCY 3 cut(s) 7, 105, 172
CviKI_1 RGCY 3 cut(s) 7, 105, 172
DpnI GATC 1 cut(s) 117
DpnII GATC 1 cut(s) 115
EcoRII CCWGG 2 cut(s) 7, 192
FaiI YATR 3 cut(s) 43, 164, 227
FalI AAGNNNNNCTT 2 cut(s) 161, 193
FaqI GGGAC 1 cut(s) 210
FbaI TGATCA 1 cut(s) 115
Fnu4HI GCNGC 4 cut(s) 36, 39, 106, 109
Fsp4HI GCNGC 4 cut(s) 36, 39, 106, 109
FspBI CTAG 1 cut(s) 102
GluI GCNGC 4 cut(s) 36, 39, 106, 109
GsuI CTGGAG 1 cut(s) 193
HindIII AAGCTT 1 cut(s) 170
HinfI GANTC 4 cut(s) 25, 98, 153, 213
Hpy188I TCNGA 1 cut(s) 186
Hpy188III TCNNGA 1 cut(s) 210
HpyCH4V TGCA 1 cut(s) 202
Ksp22I TGATCA 1 cut(s) 115
Kzo9I GATC 1 cut(s) 115
LpnPI CCDG 6 cut(s) 21, 108, 163, 179, 206, 223
Lsp1109I GCAGC 3 cut(s) 47, 50, 120
LweI GCATC 1 cut(s) 177
MaeI CTAG 1 cut(s) 102
MaeIII GTNAC 1 cut(s) 85
MalI GATC 1 cut(s) 117
MboI GATC 1 cut(s) 115
MboII GAAGA 2 cut(s) 9, 169
MluCI AATT 1 cut(s) 141
MlyI GAGTC 1 cut(s) 222
MnlI CCTC 2 cut(s) 54, 146
MspR9I CCNGG 2 cut(s) 9, 194
MvaI CCWGG 2 cut(s) 9, 194
NdeII GATC 1 cut(s) 115
NlaIV GGNNCC 1 cut(s) 133
NmuCI GTSAC 1 cut(s) 85
PasI CCCWGGG 1 cut(s) 193
PfeI GAWTC 3 cut(s) 25, 98, 153
PkrI GCNGC 4 cut(s) 37, 40, 107, 110
PleI GAGTC 1 cut(s) 221
PpsI GAGTC 1 cut(s) 221
Psp6I CCWGG 2 cut(s) 7, 192
PspGI CCWGG 2 cut(s) 7, 192
PspN4I GGNNCC 1 cut(s) 133
PstNI CAGNNNCTG 1 cut(s) 199
SatI GCNGC 4 cut(s) 36, 39, 106, 109
Sau3AI GATC 1 cut(s) 115
SchI GAGTC 1 cut(s) 222
ScrFI CCNGG 2 cut(s) 9, 194
SetI ASST 1 cut(s) 174
SfaNI GCATC 1 cut(s) 177
SgeI CNNG 9 cut(s) 20, 21, 70, 114, 135, 162, 205, 206, 222
Sse9I AATT 1 cut(s) 141
SsiI CCGC 1 cut(s) 106
SspMI CTAG 1 cut(s) 102
StyD4I CCNGG 2 cut(s) 7, 192
TasI AATT 1 cut(s) 141
TauI GCSGC 1 cut(s) 108
TfiI GAWTC 3 cut(s) 25, 98, 153
TseFI GTSAC 1 cut(s) 85
TseI GCWGC 3 cut(s) 35, 38, 108
Tsp45I GTSAC 1 cut(s) 85
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 141
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.