Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000412.1

Orthogroup ID

OG0004663

Physical Location & Seq

Genomic Coordinates Forward (+)

102622 .. 104014

Gene Structure 1393 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000412.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 528 bp

atgaagccaggagtatcttctttgaatccatatgcagcagcatacattcccctctccaaaagggaggcagatgatacaacttttgtgacatcaaaagaatctagccgcaacaatgatccactctggtttggggcccctcagaatatgacccacaatcaaaaccatagcaaagcttatcttggatctgattcctctgctactgcagcacttctcagtccaaaggcgtttgctctaaacaactaccctgcccatggttcttatggttcatcgtcacagaatgtgaatgaagtgacagcaaatgaggaatttgatatggatttggaatatcttcagatggcatttcctggtatatccgaacagtctcttgctgatgtttacttggcgaacaagggggacctggaagctgccattgacatgctgaaccaacttgagttctacacagtcgagtcttctgaagtcttccagacactttggacattggagatgtttctgaatctgggttgtcaccaaattctgcatggaaactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CUE

Protein Analysis

175

Amino Acids

19.28

Weight (kDa)

4.5

Isoelectric Point (pI)

45.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004663)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G11440 AT5G11440 AT5G25540 AT5G25540 AT5G25540
fragaria_vesca	FvH4_2g30160 FvH4_2g30160 FvH4_2g30160 FvH4_2g30160 FvH4_2g30160
malus_domestica	MD08G1136600.v1.1
prunus_persica	Prupe.1G466700_v2.0.a1 Prupe.1G466700_v2.0.a1 Prupe.1G466700_v2.0.a1 Prupe.1G466700_v2.0.a1
pyrus_communis	pycom08g11540 pycom15g10400 pycom15g10410
rosa_chinensis	RchiOBHm_Chr6g0312751
rosa_laevigata	RLG00000010301
rosa_multiflora	Rmu_ssc0000412.1_g000014
rosa_roxburghii	Rroxscaffold_7G00156530
rosa_rugosa	Rorug06G0399200 Rorug06G0399300 Rorug06G0399400 Rorug06G0399500
rosa_samantha	Rh6AG516300 Rh6BG527600 Rh6CG532500 Rh6DG518600
rosa_wichuraiana	Rw6G044860

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	106
AclWI	GGATC	2 cut(s)	110, 190
AcsI	RAATTY	2 cut(s)	305, 510
AcuI	CTGAAG	2 cut(s)	314, 474
AfiI	CCNNNNNNNGG	1 cut(s)	251
AgsI	TTSAA	1 cut(s)	25
AjnI	CCWGG	3 cut(s)	7, 343, 396
AluBI	AGCT	2 cut(s)	173, 404
AluI	AGCT	2 cut(s)	173, 404
Alw26I	GTCTC	1 cut(s)	366
AlwI	GGATC	2 cut(s)	110, 190
AoxI	GGCC	1 cut(s)	132
ApaI	GGGCCC	1 cut(s)	136
ApeKI	GCWGC	4 cut(s)	35, 38, 203, 404
ApoI	RAATTY	2 cut(s)	305, 510
Asp700I	GAANNNNTTC	1 cut(s)	327
AspS9I	GGNCC	3 cut(s)	132, 133, 394
AsuHPI	GGTGA	1 cut(s)	497
AvaII	GGWCC	1 cut(s)	394
BaeGI	GKGCMC	1 cut(s)	136
BanII	GRGCYC	1 cut(s)	136
BbsI	GAAGAC	2 cut(s)	441, 451
BbvI	GCAGC	4 cut(s)	47, 50, 215, 391
BccI	CCATC	1 cut(s)	328
BciT130I	CCWGG	3 cut(s)	9, 345, 398
BcoDI	GTCTC	1 cut(s)	366
BfaI	CTAG	1 cut(s)	102
BfmI	CTRYAG	1 cut(s)	201
BisI	GCNGC	5 cut(s)	36, 39, 106, 204, 405
BlsI	GCNGC	5 cut(s)	37, 40, 107, 205, 406
Bme1390I	CCNGG	3 cut(s)	9, 345, 398
Bme18I	GGWCC	1 cut(s)	394
BmgT120I	GGNCC	3 cut(s)	132, 133, 394
BmiI	GGNNCC	4 cut(s)	133, 134, 135, 395
BmrFI	CCNGG	3 cut(s)	9, 345, 398
BpiI	GAAGAC	2 cut(s)	441, 451
BpuEI	CTTGAG	1 cut(s)	449
BsaJI	CCNNGG	1 cut(s)	250
Bsc4I	CCNNNNNNNGG	1 cut(s)	251
BseBI	CCWGG	3 cut(s)	9, 345, 398
BseDI	CCNNGG	1 cut(s)	250
BseLI	CCNNNNNNNGG	1 cut(s)	251
BseMII	CTCAG	2 cut(s)	152, 226
BseSI	GKGCMC	1 cut(s)	136
BseXI	GCAGC	4 cut(s)	47, 50, 215, 391
BshFI	GGCC	1 cut(s)	134
BslFI	GGGAC	1 cut(s)	407
BslI	CCNNNNNNNGG	1 cut(s)	251
BsmAI	GTCTC	1 cut(s)	366
BsmFI	GGGAC	1 cut(s)	407
BsnI	GGCC	1 cut(s)	134
Bsp120I	GGGCCC	1 cut(s)	132
Bsp1286I	GDGCHC	1 cut(s)	136
Bsp143I	GATC	2 cut(s)	115, 182
Bsp19I	CCATGG	1 cut(s)	250
BspACI	CCGC	1 cut(s)	106
BspANI	GGCC	1 cut(s)	134
BspCNI	CTCAG	2 cut(s)	151, 225
BspLI	GGNNCC	4 cut(s)	133, 134, 135, 395
BspMAI	CTGCAG	1 cut(s)	205
BspPI	GGATC	2 cut(s)	110, 190
BssECI	CCNNGG	1 cut(s)	250
BssMI	GATC	2 cut(s)	115, 182
BssT1I	CCWWGG	1 cut(s)	250
Bst2UI	CCWGG	3 cut(s)	9, 345, 398
Bst4CI	ACNGT	2 cut(s)	360, 442
BstDEI	CTNAG	2 cut(s)	138, 212
BstDSI	CCRYGG	1 cut(s)	250
BstKTI	GATC	2 cut(s)	118, 185
BstMAI	GTCTC	1 cut(s)	366
BstMBI	GATC	2 cut(s)	115, 182
BstMWI	GCNNNNNNNGC	1 cut(s)	203
BstNI	CCWGG	3 cut(s)	9, 345, 398
BstNSI	RCATGY	1 cut(s)	418
BstSCI	CCNGG	3 cut(s)	7, 343, 396
BstSFI	CTRYAG	1 cut(s)	201
BstSLI	GKGCMC	1 cut(s)	136
BstV1I	GCAGC	4 cut(s)	47, 50, 215, 391
BstV2I	GAAGAC	2 cut(s)	441, 451
BstX2I	RGATCY	1 cut(s)	182
BstYI	RGATCY	1 cut(s)	182
BsuRI	GGCC	1 cut(s)	134
BtgI	CCRYGG	1 cut(s)	250
Cfr13I	GGNCC	3 cut(s)	132, 133, 394
CviAII	CATG	3 cut(s)	251, 415, 518
CviJI	RGCY	5 cut(s)	7, 105, 134, 173, 404
CviKI_1	RGCY	5 cut(s)	7, 105, 134, 173, 404
DdeI	CTNAG	2 cut(s)	138, 212
DpnI	GATC	2 cut(s)	117, 184
DpnII	GATC	2 cut(s)	115, 182
Eco130I	CCWWGG	1 cut(s)	250
Eco24I	GRGCYC	1 cut(s)	136
Eco47I	GGWCC	1 cut(s)	394
Eco57I	CTGAAG	2 cut(s)	314, 474
EcoO109I	RGGNCCY	3 cut(s)	132, 133, 394
EcoRII	CCWGG	3 cut(s)	7, 343, 396
EcoT14I	CCWWGG	1 cut(s)	250
EcoT38I	GRGCYC	1 cut(s)	136
ErhI	CCWWGG	1 cut(s)	250
FaeI	CATG	3 cut(s)	254, 418, 521
FalI	AAGNNNNNCTT	2 cut(s)	162, 194
FaqI	GGGAC	1 cut(s)	407
FatI	CATG	3 cut(s)	250, 414, 517
FauNDI	CATATG	1 cut(s)	31
Fnu4HI	GCNGC	5 cut(s)	36, 39, 106, 204, 405
FriOI	GRGCYC	1 cut(s)	136
Fsp4HI	GCNGC	5 cut(s)	36, 39, 106, 204, 405
FspBI	CTAG	1 cut(s)	102
GluI	GCNGC	5 cut(s)	36, 39, 106, 204, 405
HaeIII	GGCC	1 cut(s)	134
Hin1II	CATG	3 cut(s)	254, 418, 521
HindIII	AAGCTT	1 cut(s)	171
HinfI	GANTC	5 cut(s)	25, 98, 188, 446, 493
HphI	GGTGA	1 cut(s)	497
Hpy166II	GTNNAC	1 cut(s)	376
Hpy188I	TCNGA	6 cut(s)	141, 187, 333, 355, 454, 492
Hpy188III	TCNNGA	1 cut(s)	463
Hpy8I	GTNNAC	1 cut(s)	376
HpyCH4III	ACNGT	2 cut(s)	360, 442
HpyCH4V	TGCA	3 cut(s)	35, 203, 517
HpyF10VI	GCNNNNNNNGC	1 cut(s)	203
HpyF3I	CTNAG	2 cut(s)	138, 212
Hsp92II	CATG	3 cut(s)	254, 418, 521
Kzo9I	GATC	2 cut(s)	115, 182
LpnPI	CCDG	9 cut(s)	21, 109, 258, 330, 357, 383, 410, 476, 482
Lsp1109I	GCAGC	4 cut(s)	47, 50, 215, 391
MaeI	CTAG	1 cut(s)	102
MaeIII	GTNAC	4 cut(s)	85, 270, 289, 503
MalI	GATC	2 cut(s)	117, 184
MboI	GATC	2 cut(s)	115, 182
MboII	GAAGA	4 cut(s)	9, 320, 441, 451
MflI	RGATCY	1 cut(s)	182
MhlI	GDGCHC	1 cut(s)	136
MluCI	AATT	2 cut(s)	305, 510
MlyI	GAGTC	1 cut(s)	455
MnlI	CCTC	5 cut(s)	58, 62, 147, 202, 295
MroXI	GAANNNNTTC	1 cut(s)	327
MslI	CAYNNNNRTG	1 cut(s)	413
MspR9I	CCNGG	3 cut(s)	9, 345, 398
MvaI	CCWGG	3 cut(s)	9, 345, 398
MwoI	GCNNNNNNNGC	1 cut(s)	203
NcoI	CCATGG	1 cut(s)	250
NdeI	CATATG	1 cut(s)	31
NdeII	GATC	2 cut(s)	115, 182
NlaIII	CATG	3 cut(s)	254, 418, 521
NlaIV	GGNNCC	4 cut(s)	133, 134, 135, 395
NmuCI	GTSAC	4 cut(s)	85, 270, 289, 503
NspI	RCATGY	1 cut(s)	418
PdmI	GAANNNNTTC	1 cut(s)	327
PfeI	GAWTC	4 cut(s)	25, 98, 188, 493
PkrI	GCNGC	5 cut(s)	37, 40, 107, 205, 406
PleI	GAGTC	1 cut(s)	454
PpsI	GAGTC	1 cut(s)	454
PpuMI	RGGWCCY	1 cut(s)	394
Psp5II	RGGWCCY	1 cut(s)	394
Psp6I	CCWGG	3 cut(s)	7, 343, 396
PspGI	CCWGG	3 cut(s)	7, 343, 396
PspN4I	GGNNCC	4 cut(s)	133, 134, 135, 395
PspOMI	GGGCCC	1 cut(s)	132
PspPI	GGNCC	3 cut(s)	132, 133, 394
PspPPI	RGGWCCY	1 cut(s)	394
PstI	CTGCAG	1 cut(s)	205
PsuI	RGATCY	1 cut(s)	182
RseI	CAYNNNNRTG	1 cut(s)	413
SatI	GCNGC	5 cut(s)	36, 39, 106, 204, 405
Sau3AI	GATC	2 cut(s)	115, 182
Sau96I	GGNCC	3 cut(s)	132, 133, 394
SchI	GAGTC	1 cut(s)	455
ScrFI	CCNGG	3 cut(s)	9, 345, 398
SduI	GDGCHC	1 cut(s)	136
SetI	ASST	3 cut(s)	175, 399, 406
SfcI	CTRYAG	1 cut(s)	201
SinI	GGWCC	1 cut(s)	394
SmiMI	CAYNNNNRTG	1 cut(s)	413
SmlI	CTYRAG	1 cut(s)	428
SmoI	CTYRAG	1 cut(s)	428
Sse9I	AATT	2 cut(s)	305, 510
SsiI	CCGC	1 cut(s)	106
SspMI	CTAG	1 cut(s)	102
StyD4I	CCNGG	3 cut(s)	7, 343, 396
StyI	CCWWGG	1 cut(s)	250
TaaI	ACNGT	2 cut(s)	360, 442
TaqI	TCGA	1 cut(s)	444
TasI	AATT	2 cut(s)	305, 510
TauI	GCSGC	1 cut(s)	108
TfiI	GAWTC	4 cut(s)	25, 98, 188, 493
TseFI	GTSAC	4 cut(s)	85, 270, 289, 503
TseI	GCWGC	4 cut(s)	35, 38, 203, 404
Tsp45I	GTSAC	4 cut(s)	85, 270, 289, 503
TspDTI	ATGAA	3 cut(s)	17, 255, 300
VpaK11BI	GGWCC	1 cut(s)	394
XapI	RAATTY	2 cut(s)	305, 510
XceI	RCATGY	1 cut(s)	418
XcmI	CCANNNNNNNNNTGG	2 cut(s)	257, 515
XmnI	GAANNNNTTC	1 cut(s)	327
XspI	CTAG	1 cut(s)	102

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.