MD08G1220000.v1.1

Catalytic subunit of the peripheral V1 complex of vacuolar ATPase (V-ATPase). V-ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
OG0008981
Physical Location & Seq
Forward (+)
28286994 .. 28287652
659 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1220000.v1.1.491

Sequence Viewer

Length: 333 bp
ATGGATTCGGTTAGAGGACAAGGAGGCATCCAGATGTTGCTAACAGCAGAACAGGATGCTCAACAAATTGTGAACAATGCTAGAAACTCGAAGATGGCACGCTTGAGACAAGCTAAAGAAGAAGCTGATAGGGAAGTGCAACTCTATCGCATGAATATGGAGGCTGAGCACCAAAAGAAAATTGCAGATACAAGTGGGAGTTCAGGATCCAATGTGAAAAGGCTCGAAGAGGAAACTGATACGAAAATTAAGAACTTGAAGGAGTCAGCCTCAAAGGTCCAATCGGATATCGTTGGCATGCTTATTAAGTATGTCACAACTGTTAAAATTTGA

Protein Analysis

111

Amino Acids

12.34

Weight (kDa)

8.92

Isoelectric Point (pI)

28.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
V-ATPase_G PF03179 7 - 109 7.4e-31 Vacuolar (H+)-ATPase G subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 201, 214
AcsI RAATTY 1 cut(s) 327
AgsI TTSAA 1 cut(s) 259
AluBI AGCT 2 cut(s) 113, 125
AluI AGCT 2 cut(s) 113, 125
Alw21I GWGCWC 1 cut(s) 171
Alw26I GTCTC 1 cut(s) 100
AlwI GGATC 2 cut(s) 201, 214
ApoI RAATTY 1 cut(s) 327
AspS9I GGNCC 1 cut(s) 277
AvaII GGWCC 1 cut(s) 277
BamHI GGATCC 1 cut(s) 206
Bbv12I GWGCWC 1 cut(s) 171
BccI CCATC 1 cut(s) 88
BcgI CGANNNNNNTGC 2 cut(s) 128, 162
BcoDI GTCTC 1 cut(s) 100
BfaI CTAG 1 cut(s) 81
BlpI GCTNAGC 1 cut(s) 165
Bme18I GGWCC 1 cut(s) 277
BmgT120I GGNCC 1 cut(s) 277
BmiI GGNNCC 1 cut(s) 208
BmsI GCATC 2 cut(s) 36, 46
BplI GAGNNNNNCTC 2 cut(s) 254, 286
Bpu1102I GCTNAGC 1 cut(s) 165
BpuEI CTTGAG 1 cut(s) 124
BseGI GGATG 2 cut(s) 27, 61
BseMII CTCAG 1 cut(s) 156
BsiHKAI GWGCWC 1 cut(s) 171
BsmAI GTCTC 1 cut(s) 100
Bsp1286I GDGCHC 1 cut(s) 171
Bsp143I GATC 1 cut(s) 206
Bsp1720I GCTNAGC 1 cut(s) 165
BspCNI CTCAG 1 cut(s) 157
BspLI GGNNCC 1 cut(s) 208
BspPI GGATC 2 cut(s) 201, 214
BssMI GATC 1 cut(s) 206
Bst4CI ACNGT 1 cut(s) 322
Bst6I CTCTTC 1 cut(s) 222
BstC8I GCNNGC 2 cut(s) 100, 299
BstDEI CTNAG 1 cut(s) 165
BstF5I GGATG 2 cut(s) 27, 61
BstKTI GATC 1 cut(s) 209
BstMAI GTCTC 1 cut(s) 100
BstMBI GATC 1 cut(s) 206
BstNSI RCATGY 1 cut(s) 301
BstX2I RGATCY 1 cut(s) 206
BstYI RGATCY 1 cut(s) 206
BtsCI GGATG 2 cut(s) 27, 61
Cac8I GCNNGC 2 cut(s) 100, 299
Cfr13I GGNCC 1 cut(s) 277
CviAII CATG 2 cut(s) 151, 298
CviJI RGCY 5 cut(s) 113, 125, 164, 223, 269
CviKI_1 RGCY 5 cut(s) 113, 125, 164, 223, 269
DdeI CTNAG 1 cut(s) 165
DpnI GATC 1 cut(s) 208
DpnII GATC 1 cut(s) 206
Eam1104I CTCTTC 1 cut(s) 222
EarI CTCTTC 1 cut(s) 222
Eco32I GATATC 1 cut(s) 289
Eco47I GGWCC 1 cut(s) 277
EcoRV GATATC 1 cut(s) 289
FaeI CATG 2 cut(s) 154, 301
FaiI YATR 4 cut(s) 152, 158, 299, 312
FatI CATG 2 cut(s) 150, 297
FokI GGATG 2 cut(s) 14, 68
FspBI CTAG 1 cut(s) 81
Hin1II CATG 2 cut(s) 154, 301
HinfI GANTC 2 cut(s) 5, 263
Hpy166II GTNNAC 1 cut(s) 73
Hpy188I TCNGA 1 cut(s) 286
Hpy188III TCNNGA 2 cut(s) 31, 204
Hpy8I GTNNAC 1 cut(s) 73
HpyAV CCTTC 1 cut(s) 253
HpyCH4III ACNGT 1 cut(s) 322
HpyCH4V TGCA 2 cut(s) 139, 185
HpyF3I CTNAG 1 cut(s) 165
Hsp92II CATG 2 cut(s) 154, 301
Kzo9I GATC 1 cut(s) 206
LpnPI CCDG 3 cut(s) 38, 44, 189
LweI GCATC 2 cut(s) 36, 46
MaeI CTAG 1 cut(s) 81
MaeIII GTNAC 1 cut(s) 313
MalI GATC 1 cut(s) 208
MboI GATC 1 cut(s) 206
MboII GAAGA 3 cut(s) 103, 131, 239
MflI RGATCY 1 cut(s) 206
MhlI GDGCHC 1 cut(s) 171
MluCI AATT 4 cut(s) 66, 180, 246, 327
MlyI GAGTC 1 cut(s) 272
MnlI CCTC 5 cut(s) 8, 17, 154, 223, 280
MseI TTAA 3 cut(s) 249, 306, 324
MslI CAYNNNNRTG 2 cut(s) 32, 155
NdeII GATC 1 cut(s) 206
NlaIII CATG 2 cut(s) 154, 301
NlaIV GGNNCC 1 cut(s) 208
NmuCI GTSAC 1 cut(s) 313
NspI RCATGY 1 cut(s) 301
PaeI GCATGC 1 cut(s) 301
PfeI GAWTC 1 cut(s) 5
PleI GAGTC 1 cut(s) 271
PpsI GAGTC 1 cut(s) 271
PspN4I GGNNCC 1 cut(s) 208
PspPI GGNCC 1 cut(s) 277
PsuI RGATCY 1 cut(s) 206
RseI CAYNNNNRTG 2 cut(s) 32, 155
SaqAI TTAA 3 cut(s) 249, 306, 324
Sau3AI GATC 1 cut(s) 206
Sau96I GGNCC 1 cut(s) 277
SchI GAGTC 1 cut(s) 272
SduI GDGCHC 1 cut(s) 171
SetI ASST 3 cut(s) 115, 127, 279
SfaNI GCATC 2 cut(s) 36, 46
SinI GGWCC 1 cut(s) 277
SmiMI CAYNNNNRTG 2 cut(s) 32, 155
SmlI CTYRAG 1 cut(s) 103
SmoI CTYRAG 1 cut(s) 103
SphI GCATGC 1 cut(s) 301
Sse9I AATT 4 cut(s) 66, 180, 246, 327
SspMI CTAG 1 cut(s) 81
TaaI ACNGT 1 cut(s) 322
TaqI TCGA 2 cut(s) 89, 225
TasI AATT 4 cut(s) 66, 180, 246, 327
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 3 cut(s) 249, 306, 324
Tru9I TTAA 3 cut(s) 249, 306, 324
TseFI GTSAC 1 cut(s) 313
Tsp45I GTSAC 1 cut(s) 313
TspDTI ATGAA 1 cut(s) 167
VpaK11BI GGWCC 1 cut(s) 277
XapI RAATTY 1 cut(s) 327
XceI RCATGY 1 cut(s) 301
XspI CTAG 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.