MD09G1008600.v1.1

Enoyl-(Acyl carrier protein) reductase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0002467
Physical Location & Seq
Reverse (-)
604340 .. 605141
802 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1008600.v1.1.491

Sequence Viewer

Length: 219 bp
ATGGAGTTGTCACGATACAAGGAGAGATGCAAACACTCAGAAGATTGCTCAACAGAGATTCTACATGTTTCTGAGGCAGAAGTTAAAGAGATCGAAATGATGGAACATGCTCTCATAATTATTGTAACGTTCCAAACGCAGCAAGTGTACTGTGTACGAGATAGAAATCGTGATGTAACAGATGGTGGACACAATCCACACGGTGTATATTATGCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
adh_short_C2

Protein Analysis

73

Amino Acids

8.44

Weight (kDa)

5.41

Isoelectric Point (pI)

38.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Tim44 PF04280 7 - 67 4.3e-09 Tim44-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 128
AdeI CACNNNGTG 1 cut(s) 203
AfaI GTAC 2 cut(s) 149, 156
AflIII ACRYGT 1 cut(s) 64
ApeKI GCWGC 1 cut(s) 139
BbvI GCAGC 1 cut(s) 151
BccI CCATC 2 cut(s) 94, 176
BfaI CTAG 1 cut(s) 217
BisI GCNGC 1 cut(s) 140
BlsI GCNGC 1 cut(s) 141
BmsI GCATC 1 cut(s) 17
BsaBI GATNNNNATC 1 cut(s) 165
Bse8I GATNNNNATC 1 cut(s) 165
BseJI GATNNNNATC 1 cut(s) 165
BseMII CTCAG 2 cut(s) 51, 63
BseXI GCAGC 1 cut(s) 151
Bsp143I GATC 1 cut(s) 90
BspCNI CTCAG 2 cut(s) 50, 64
BssMI GATC 1 cut(s) 90
Bst4CI ACNGT 2 cut(s) 152, 203
BstDEI CTNAG 2 cut(s) 37, 72
BstKTI GATC 1 cut(s) 93
BstMBI GATC 1 cut(s) 90
BstNSI RCATGY 2 cut(s) 68, 110
BstV1I GCAGC 1 cut(s) 151
Csp6I GTAC 2 cut(s) 148, 155
CviAII CATG 2 cut(s) 65, 107
CviQI GTAC 2 cut(s) 148, 155
DdeI CTNAG 2 cut(s) 37, 72
DpnI GATC 1 cut(s) 92
DpnII GATC 1 cut(s) 90
DraIII CACNNNGTG 1 cut(s) 203
FaeI CATG 2 cut(s) 68, 110
FaiI YATR 5 cut(s) 66, 108, 116, 208, 213
FatI CATG 2 cut(s) 64, 106
Fnu4HI GCNGC 1 cut(s) 140
Fsp4HI GCNGC 1 cut(s) 140
FspBI CTAG 1 cut(s) 217
FspEI CC 8 cut(s) 5, 59, 86, 146, 168, 171, 186, 210
GluI GCNGC 1 cut(s) 140
Hin1II CATG 2 cut(s) 68, 110
HinfI GANTC 1 cut(s) 58
Hpy166II GTNNAC 3 cut(s) 148, 155, 188
Hpy188I TCNGA 2 cut(s) 40, 73
Hpy188III TCNNGA 2 cut(s) 12, 170
Hpy8I GTNNAC 3 cut(s) 148, 155, 188
HpyCH4III ACNGT 2 cut(s) 152, 203
HpyCH4IV ACGT 1 cut(s) 128
HpyCH4V TGCA 1 cut(s) 30
HpyF3I CTNAG 2 cut(s) 37, 72
HpySE526I ACGT 1 cut(s) 128
Hsp92II CATG 2 cut(s) 68, 110
Kzo9I GATC 1 cut(s) 90
Lsp1109I GCAGC 1 cut(s) 151
LweI GCATC 1 cut(s) 17
MaeI CTAG 1 cut(s) 217
MaeII ACGT 1 cut(s) 128
MaeIII GTNAC 3 cut(s) 9, 124, 175
MalI GATC 1 cut(s) 92
MboI GATC 1 cut(s) 90
MboII GAAGA 1 cut(s) 53
MluCI AATT 1 cut(s) 117
MnlI CCTC 1 cut(s) 67
MseI TTAA 1 cut(s) 84
NdeII GATC 1 cut(s) 90
NlaIII CATG 2 cut(s) 68, 110
NmuCI GTSAC 1 cut(s) 9
NspI RCATGY 2 cut(s) 68, 110
PciI ACATGT 1 cut(s) 64
PfeI GAWTC 1 cut(s) 58
PkrI GCNGC 1 cut(s) 141
PscI ACATGT 1 cut(s) 64
Psp1406I AACGTT 1 cut(s) 128
RsaI GTAC 2 cut(s) 149, 156
RsaNI GTAC 2 cut(s) 148, 155
SaqAI TTAA 1 cut(s) 84
SatI GCNGC 1 cut(s) 140
Sau3AI GATC 1 cut(s) 90
SetI ASST 1 cut(s) 131
SfaNI GCATC 1 cut(s) 17
SgeI CNNG 8 cut(s) 24, 31, 77, 119, 155, 170, 182, 212
Sse9I AATT 1 cut(s) 117
SspMI CTAG 1 cut(s) 217
TaaI ACNGT 2 cut(s) 152, 203
TaiI ACGT 1 cut(s) 131
TaqI TCGA 1 cut(s) 93
TasI AATT 1 cut(s) 117
TatI WGTACW 1 cut(s) 147
TfiI GAWTC 1 cut(s) 58
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TseFI GTSAC 1 cut(s) 9
TseI GCWGC 1 cut(s) 139
Tsp45I GTSAC 1 cut(s) 9
XceI RCATGY 2 cut(s) 68, 110
XspI CTAG 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.