MD09G1063300.v1.1

Protein of unknown function (DUF1068)

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Reverse (-)
4331788 .. 4333478
1691 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1063300.v1.1.491

Sequence Viewer

Length: 147 bp
ATGGCTCTGCTGGAGGCTAAGAAGATTGCATCCCAGTATCAAAAGGAAGCAGACAAGTGCAGTTCAGGGATGGAAACATGTGAAGAAGCAAGGGAGAAAGGAAGGGATGAAAATATTGTCGTCGGTGCTTCCTACCTTTTCCGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.39

Weight (kDa)

5.29

Isoelectric Point (pI)

22.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1068 PF06364 1 - 34 3.7e-17 Protein of unknown function (DUF1068)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010168)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 77
BccI CCATC 1 cut(s) 64
BmrI ACTGGG 1 cut(s) 28
BmsI GCATC 1 cut(s) 38
BmuI ACTGGG 1 cut(s) 28
BpmI CTGGAG 1 cut(s) 32
Bse1I ACTGG 1 cut(s) 34
BseGI GGATG 3 cut(s) 29, 75, 112
BseNI ACTGG 1 cut(s) 34
BsgI GTGCAG 1 cut(s) 79
BsrI ACTGG 1 cut(s) 34
BstDEI CTNAG 1 cut(s) 18
BstF5I GGATG 3 cut(s) 29, 75, 112
BstNSI RCATGY 1 cut(s) 81
BtsCI GGATG 3 cut(s) 29, 75, 112
CviAII CATG 1 cut(s) 78
CviJI RGCY 2 cut(s) 5, 17
CviKI_1 RGCY 2 cut(s) 5, 17
DdeI CTNAG 1 cut(s) 18
FaeI CATG 1 cut(s) 81
FaiI YATR 1 cut(s) 79
FatI CATG 1 cut(s) 77
FokI GGATG 3 cut(s) 16, 82, 119
GsuI CTGGAG 1 cut(s) 32
Hin1II CATG 1 cut(s) 81
Hpy188I TCNGA 1 cut(s) 143
Hpy99I CGWCG 1 cut(s) 125
HpyAV CCTTC 1 cut(s) 96
HpyCH4V TGCA 2 cut(s) 29, 60
HpyF3I CTNAG 1 cut(s) 18
Hsp92II CATG 1 cut(s) 81
LpnPI CCDG 2 cut(s) 47, 51
LweI GCATC 1 cut(s) 38
MboII GAAGA 2 cut(s) 34, 95
MnlI CCTC 1 cut(s) 7
NlaIII CATG 1 cut(s) 81
NspI RCATGY 1 cut(s) 81
PciI ACATGT 1 cut(s) 77
PscI ACATGT 1 cut(s) 77
SetI ASST 1 cut(s) 138
SfaNI GCATC 1 cut(s) 38
SgeI CNNG 6 cut(s) 23, 46, 67, 78, 90, 102
SspI AATATT 1 cut(s) 115
TspDTI ATGAA 1 cut(s) 123
XceI RCATGY 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.