MD09G1262700.v1.1

EF-hand domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0006584
Physical Location & Seq
Reverse (-)
33589240 .. 33589497
258 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1262700.v1.1.491

Sequence Viewer

Length: 258 bp
ATGGCAGAAGAAGATCCTAAAGAAAAGGCTGATCGGGAGCGCATTTTCAAGCGATTTGACACGAATGGCGATGGCAAAATCTCTGCAGCTGAGCTAGGAGATGCATTGGAAACCCTAGGCTGCGTTAAACCAGATGAAGTGAAATCTATGATGACGGAGATTGATACCGACGGTGATGGCTTCATTTCGTACCAAGAATATTTAGATTTTGCTCTAGCTAACCGTGGTTTAATTAAAGATATTGCCAAAATATTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
EF-hand_1

Protein Analysis

86

Amino Acids

9.51

Weight (kDa)

4.43

Isoelectric Point (pI)

8.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_1 PF00036 13 - 38 1.7e-07 EF hand domain
AIF-1 PF21008 13 - 80 1.9e-07 Allograft inflammatory factor 1
EF-hand_7 PF13499 14 - 71 5.5e-16 EF-hand domain pair
EF-hand_6 PF13405 14 - 40 2.5e-08 EF-hand domain
EF-hand_5 PF13202 15 - 33 4e-07 EF hand
EF-hand_8 PF13833 27 - 71 6.5e-06 EF-hand domain pair
EF-hand_1 PF00036 46 - 70 3.7e-07 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 8
AfaI GTAC 1 cut(s) 191
AgsI TTSAA 1 cut(s) 49
AluBI AGCT 3 cut(s) 89, 94, 218
AluI AGCT 3 cut(s) 89, 94, 218
AlwI GGATC 1 cut(s) 8
ApeKI GCWGC 2 cut(s) 86, 120
AspA2I CCTAGG 1 cut(s) 115
AspLEI GCGC 1 cut(s) 42
AsuHPI GGTGA 1 cut(s) 185
AvrII CCTAGG 1 cut(s) 115
BbvI GCAGC 2 cut(s) 98, 107
BccI CCATC 2 cut(s) 65, 170
BfaI CTAG 3 cut(s) 95, 116, 215
BfmI CTRYAG 1 cut(s) 84
BisI GCNGC 2 cut(s) 87, 121
BlnI CCTAGG 1 cut(s) 115
BlpI GCTNAGC 1 cut(s) 90
BlsI GCNGC 2 cut(s) 88, 122
BmsI GCATC 1 cut(s) 91
Bpu1102I GCTNAGC 1 cut(s) 90
BsaJI CCNNGG 2 cut(s) 115, 223
BseDI CCNNGG 2 cut(s) 115, 223
BseMII CTCAG 1 cut(s) 81
BseXI GCAGC 2 cut(s) 98, 107
Bsp143I GATC 2 cut(s) 13, 31
Bsp1720I GCTNAGC 1 cut(s) 90
BspCNI CTCAG 1 cut(s) 82
BspMAI CTGCAG 1 cut(s) 88
BspPI GGATC 1 cut(s) 8
BssECI CCNNGG 2 cut(s) 115, 223
BssMI GATC 2 cut(s) 13, 31
BssT1I CCWWGG 1 cut(s) 115
Bst4CI ACNGT 2 cut(s) 173, 224
BstDEI CTNAG 1 cut(s) 90
BstDSI CCRYGG 1 cut(s) 223
BstHHI GCGC 1 cut(s) 42
BstKTI GATC 2 cut(s) 16, 34
BstMBI GATC 2 cut(s) 13, 31
BstSFI CTRYAG 1 cut(s) 84
BstV1I GCAGC 2 cut(s) 98, 107
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
BtgI CCRYGG 1 cut(s) 223
BtgZI GCGATG 1 cut(s) 84
CfoI GCGC 1 cut(s) 42
Csp6I GTAC 1 cut(s) 190
CviJI RGCY 6 cut(s) 29, 89, 94, 120, 180, 218
CviKI_1 RGCY 6 cut(s) 29, 89, 94, 120, 180, 218
CviQI GTAC 1 cut(s) 190
DdeI CTNAG 1 cut(s) 90
DpnI GATC 2 cut(s) 15, 33
DpnII GATC 2 cut(s) 13, 31
Eco130I CCWWGG 1 cut(s) 115
EcoT14I CCWWGG 1 cut(s) 115
EcoT22I ATGCAT 1 cut(s) 106
ErhI CCWWGG 1 cut(s) 115
FaiI YATR 1 cut(s) 149
Fnu4HI GCNGC 2 cut(s) 87, 121
Fsp4HI GCNGC 2 cut(s) 87, 121
FspBI CTAG 3 cut(s) 95, 116, 215
GlaI GCGC 1 cut(s) 41
GluI GCNGC 2 cut(s) 87, 121
HhaI GCGC 1 cut(s) 42
Hin6I GCGC 1 cut(s) 40
HinP1I GCGC 1 cut(s) 40
HphI GGTGA 1 cut(s) 185
Hpy188III TCNNGA 1 cut(s) 35
Hpy99I CGWCG 1 cut(s) 173
HpyCH4III ACNGT 2 cut(s) 173, 224
HpyCH4V TGCA 2 cut(s) 86, 104
HpyF3I CTNAG 1 cut(s) 90
HspAI GCGC 1 cut(s) 40
Kzo9I GATC 2 cut(s) 13, 31
LmnI GCTCC 1 cut(s) 37
LpnPI CCDG 1 cut(s) 144
Lsp1109I GCAGC 2 cut(s) 98, 107
LweI GCATC 1 cut(s) 91
MaeI CTAG 3 cut(s) 95, 116, 215
MalI GATC 2 cut(s) 15, 33
MboI GATC 2 cut(s) 13, 31
MboII GAAGA 2 cut(s) 20, 23
MflI RGATCY 1 cut(s) 13
MluCI AATT 1 cut(s) 231
Mph1103I ATGCAT 1 cut(s) 106
MseI TTAA 3 cut(s) 126, 230, 234
MspA1I CMGCKG 1 cut(s) 89
NdeII GATC 2 cut(s) 13, 31
NsiI ATGCAT 1 cut(s) 106
PacI TTAATTAA 1 cut(s) 234
PkrI GCNGC 2 cut(s) 88, 122
PstI CTGCAG 1 cut(s) 88
PsuI RGATCY 1 cut(s) 13
PvuII CAGCTG 1 cut(s) 89
RsaI GTAC 1 cut(s) 191
RsaNI GTAC 1 cut(s) 190
SaqAI TTAA 3 cut(s) 126, 230, 234
SatI GCNGC 2 cut(s) 87, 121
Sau3AI GATC 2 cut(s) 13, 31
SetI ASST 3 cut(s) 91, 96, 220
SfaNI GCATC 1 cut(s) 91
SfcI CTRYAG 1 cut(s) 84
SgeI CNNG 9 cut(s) 47, 61, 73, 107, 128, 143, 206, 227, 236
Sse9I AATT 1 cut(s) 231
SspI AATATT 2 cut(s) 200, 252
SspMI CTAG 3 cut(s) 95, 116, 215
StyI CCWWGG 1 cut(s) 115
TaaI ACNGT 2 cut(s) 173, 224
TasI AATT 1 cut(s) 231
Tru1I TTAA 3 cut(s) 126, 230, 234
Tru9I TTAA 3 cut(s) 126, 230, 234
TseI GCWGC 2 cut(s) 86, 120
TspDTI ATGAA 2 cut(s) 150, 172
TspGWI ACGGA 1 cut(s) 170
XmaJI CCTAGG 1 cut(s) 115
XspI CTAG 3 cut(s) 95, 116, 215
Zsp2I ATGCAT 1 cut(s) 106
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.