Prupe.3G160400_v2.0.a1

EF-hand domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
OG0006584
Physical Location & Seq
Reverse (-)
17920995 .. 17921290
296 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G160400.1

Sequence Viewer

Length: 258 bp
ATGGCTGAAGAAGATCCACAAGAAAAGGTCGACCGTGAGCGCATTTTCAAGCGCTTCGACACCAATGGTGACGGAAAAATCTCTGCATCGGAACTAGGGGATGCATTGAAAACCCTCGGCTGCGTTCAATCGGATGAAGTGAAATTTATGATGGCAGAGATTGATACCGACGGTGACGGCTACATTTCGTACCAGGAGTACATAGCTTTTGCTCTAGCTAACCGTGGTTTAATGAAGGATATTGCTAAGATATTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
EF-hand_1

Protein Analysis

86

Amino Acids

9.56

Weight (kDa)

4.45

Isoelectric Point (pI)

20.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 30
AclWI GGATC 1 cut(s) 8
AcsI RAATTY 1 cut(s) 143
AcuI CTGAAG 1 cut(s) 27
AfaI GTAC 2 cut(s) 191, 200
AfeI AGCGCT 1 cut(s) 53
AgsI TTSAA 3 cut(s) 49, 109, 128
AjnI CCWGG 1 cut(s) 192
AluBI AGCT 2 cut(s) 206, 218
AluI AGCT 2 cut(s) 206, 218
AlwI GGATC 1 cut(s) 8
Aor51HI AGCGCT 1 cut(s) 53
ApeKI GCWGC 1 cut(s) 120
ApoI RAATTY 1 cut(s) 143
AspLEI GCGC 2 cut(s) 42, 54
AsuHPI GGTGA 2 cut(s) 80, 185
BbvI GCAGC 1 cut(s) 107
BccI CCATC 1 cut(s) 145
BceAI ACGGC 1 cut(s) 193
BciT130I CCWGG 1 cut(s) 194
BfaI CTAG 2 cut(s) 95, 215
BfoI RGCGCY 1 cut(s) 55
BisI GCNGC 1 cut(s) 121
BlsI GCNGC 1 cut(s) 122
Bme1390I CCNGG 1 cut(s) 194
BmrFI CCNGG 1 cut(s) 194
BmsI GCATC 2 cut(s) 91, 95
BsaJI CCNNGG 2 cut(s) 115, 223
BseBI CCWGG 1 cut(s) 194
BseDI CCNNGG 2 cut(s) 115, 223
BseGI GGATG 2 cut(s) 106, 139
BseXI GCAGC 1 cut(s) 107
Bsh1285I CGRYCG 1 cut(s) 34
BsiEI CGRYCG 1 cut(s) 34
Bsp143I GATC 1 cut(s) 13
BspPI GGATC 1 cut(s) 8
BssECI CCNNGG 2 cut(s) 115, 223
BssMI GATC 1 cut(s) 13
Bst2UI CCWGG 1 cut(s) 194
Bst4CI ACNGT 3 cut(s) 35, 173, 224
BstDEI CTNAG 1 cut(s) 246
BstDSI CCRYGG 1 cut(s) 223
BstF5I GGATG 2 cut(s) 106, 139
BstH2I RGCGCY 1 cut(s) 55
BstHHI GCGC 2 cut(s) 42, 54
BstKTI GATC 1 cut(s) 16
BstMBI GATC 1 cut(s) 13
BstMCI CGRYCG 1 cut(s) 34
BstNI CCWGG 1 cut(s) 194
BstSCI CCNGG 1 cut(s) 192
BstV1I GCAGC 1 cut(s) 107
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
BtgI CCRYGG 1 cut(s) 223
BtsCI GGATG 2 cut(s) 106, 139
CfoI GCGC 2 cut(s) 42, 54
Csp6I GTAC 2 cut(s) 190, 199
CviJI RGCY 5 cut(s) 5, 120, 180, 206, 218
CviKI_1 RGCY 5 cut(s) 5, 120, 180, 206, 218
CviQI GTAC 2 cut(s) 190, 199
DdeI CTNAG 1 cut(s) 246
DpnI GATC 1 cut(s) 15
DpnII GATC 1 cut(s) 13
Eco47III AGCGCT 1 cut(s) 53
Eco57I CTGAAG 1 cut(s) 27
EcoRII CCWGG 1 cut(s) 192
EcoT22I ATGCAT 1 cut(s) 106
FaiI YATR 2 cut(s) 149, 203
FblI GTMKAC 1 cut(s) 30
Fnu4HI GCNGC 1 cut(s) 121
FokI GGATG 2 cut(s) 113, 146
Fsp4HI GCNGC 1 cut(s) 121
FspBI CTAG 2 cut(s) 95, 215
GlaI GCGC 2 cut(s) 41, 53
GluI GCNGC 1 cut(s) 121
HaeII RGCGCY 1 cut(s) 55
HhaI GCGC 2 cut(s) 42, 54
Hin6I GCGC 2 cut(s) 40, 52
HinP1I GCGC 2 cut(s) 40, 52
HincII GTYRAC 1 cut(s) 31
HindII GTYRAC 1 cut(s) 31
HphI GGTGA 2 cut(s) 80, 185
Hpy166II GTNNAC 1 cut(s) 31
Hpy188I TCNGA 2 cut(s) 91, 133
Hpy8I GTNNAC 1 cut(s) 31
Hpy99I CGWCG 1 cut(s) 173
HpyAV CCTTC 1 cut(s) 229
HpyCH4III ACNGT 3 cut(s) 35, 173, 224
HpyCH4V TGCA 2 cut(s) 86, 104
HpyF3I CTNAG 1 cut(s) 246
HspAI GCGC 2 cut(s) 40, 52
Kzo9I GATC 1 cut(s) 13
LpnPI CCDG 2 cut(s) 179, 206
Lsp1109I GCAGC 1 cut(s) 107
LweI GCATC 2 cut(s) 91, 95
MaeI CTAG 2 cut(s) 95, 215
MaeIII GTNAC 2 cut(s) 68, 173
MalI GATC 1 cut(s) 15
MboI GATC 1 cut(s) 13
MboII GAAGA 2 cut(s) 20, 23
MflI RGATCY 1 cut(s) 13
MluCI AATT 1 cut(s) 143
MnlI CCTC 1 cut(s) 125
Mph1103I ATGCAT 1 cut(s) 106
MseI TTAA 1 cut(s) 230
MspR9I CCNGG 1 cut(s) 194
MvaI CCWGG 1 cut(s) 194
NdeII GATC 1 cut(s) 13
NmeAIII GCCGAG 1 cut(s) 96
NmuCI GTSAC 2 cut(s) 68, 173
NsiI ATGCAT 1 cut(s) 106
PkrI GCNGC 1 cut(s) 122
Psp6I CCWGG 1 cut(s) 192
PspGI CCWGG 1 cut(s) 192
PsuI RGATCY 1 cut(s) 13
RsaI GTAC 2 cut(s) 191, 200
RsaNI GTAC 2 cut(s) 190, 199
SalI GTCGAC 1 cut(s) 29
SaqAI TTAA 1 cut(s) 230
SatI GCNGC 1 cut(s) 121
Sau3AI GATC 1 cut(s) 13
ScrFI CCNGG 1 cut(s) 194
SetI ASST 3 cut(s) 30, 208, 220
SfaNI GCATC 2 cut(s) 91, 95
SgeI CNNG 9 cut(s) 32, 47, 61, 107, 128, 205, 206, 227, 236
Sse9I AATT 1 cut(s) 143
SspMI CTAG 2 cut(s) 95, 215
StyD4I CCNGG 1 cut(s) 192
TaaI ACNGT 3 cut(s) 35, 173, 224
TaqI TCGA 2 cut(s) 30, 57
TasI AATT 1 cut(s) 143
TatI WGTACW 1 cut(s) 198
Tru1I TTAA 1 cut(s) 230
Tru9I TTAA 1 cut(s) 230
TseFI GTSAC 2 cut(s) 68, 173
TseI GCWGC 1 cut(s) 120
Tsp45I GTSAC 2 cut(s) 68, 173
TspDTI ATGAA 2 cut(s) 150, 248
TspGWI ACGGA 1 cut(s) 87
XapI RAATTY 1 cut(s) 143
XmiI GTMKAC 1 cut(s) 30
XspI CTAG 2 cut(s) 95, 215
Zsp2I ATGCAT 1 cut(s) 106
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.