Rroxscaffold_6G00391610

EF-hand domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Reverse (-)
10175076 .. 10175333
258 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00391610.1

Sequence Viewer

Length: 258 bp
ATGGCTGAAGAGGATCCCAAAGAAAAGGCCGACCGTGAGCGCATTTTCAAGCACTTCGACACCAATGGCGATGGCAAAATCTCATCAGATGAGCTTGGGGATGCATTGAAAGCCCTTGGATGCGTTTCACCAGAAGAAATCAAATTCATGATGGAAGAGATTGACACCGACGGCGACGGCTTCATTTCTTACGAGGAGTATATATCTTTTGCACTTGCTAACCGTGGTCTAATGAAGGATATTGCCAAGATATTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.58

Weight (kDa)

4.4

Isoelectric Point (pI)

24.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_1 PF00036 13 - 39 7.9e-09 EF hand domain
EF-hand_7 PF13499 14 - 71 7.1e-17 EF-hand domain pair
EF-hand_6 PF13405 14 - 40 5.3e-09 EF-hand domain
EF-hand_5 PF13202 15 - 33 1.7e-06 EF hand
EF-hand_8 PF13833 26 - 71 2.6e-07 EF-hand domain pair
EF-hand_1 PF00036 46 - 70 1.2e-07 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 8, 21
AcsI RAATTY 1 cut(s) 143
AcuI CTGAAG 1 cut(s) 27
AgsI TTSAA 2 cut(s) 49, 109
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
AlwI GGATC 2 cut(s) 8, 21
AoxI GGCC 1 cut(s) 27
ApoI RAATTY 1 cut(s) 143
AspLEI GCGC 1 cut(s) 42
AsuHPI GGTGA 1 cut(s) 120
BamHI GGATCC 1 cut(s) 13
BccI CCATC 2 cut(s) 65, 145
BceAI ACGGC 2 cut(s) 187, 193
BmiI GGNNCC 1 cut(s) 15
BmsI GCATC 2 cut(s) 91, 110
BsaJI CCNNGG 2 cut(s) 115, 223
BseDI CCNNGG 2 cut(s) 115, 223
BseGI GGATG 2 cut(s) 106, 125
BseRI GAGGAG 1 cut(s) 209
Bsh1285I CGRYCG 1 cut(s) 34
BshFI GGCC 1 cut(s) 29
BsiEI CGRYCG 1 cut(s) 34
BsnI GGCC 1 cut(s) 29
Bsp143I GATC 1 cut(s) 13
BspANI GGCC 1 cut(s) 29
BspHI TCATGA 1 cut(s) 147
BspLI GGNNCC 1 cut(s) 15
BspPI GGATC 2 cut(s) 8, 21
BssECI CCNNGG 2 cut(s) 115, 223
BssMI GATC 1 cut(s) 13
BssT1I CCWWGG 1 cut(s) 115
Bst4CI ACNGT 2 cut(s) 35, 224
Bst6I CTCTTC 2 cut(s) 3, 150
BstDSI CCRYGG 1 cut(s) 223
BstF5I GGATG 2 cut(s) 106, 125
BstHHI GCGC 1 cut(s) 42
BstKTI GATC 1 cut(s) 16
BstMBI GATC 1 cut(s) 13
BstMCI CGRYCG 1 cut(s) 34
BstMWI GCNNNNNNNGC 1 cut(s) 110
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
BsuRI GGCC 1 cut(s) 29
BtgI CCRYGG 1 cut(s) 223
BtgZI GCGATG 1 cut(s) 84
BtsCI GGATG 2 cut(s) 106, 125
CciI TCATGA 1 cut(s) 147
CfoI GCGC 1 cut(s) 42
CviAII CATG 1 cut(s) 148
CviJI RGCY 5 cut(s) 5, 29, 94, 113, 180
CviKI_1 RGCY 5 cut(s) 5, 29, 94, 113, 180
DpnI GATC 1 cut(s) 15
DpnII GATC 1 cut(s) 13
Eam1104I CTCTTC 2 cut(s) 3, 150
EarI CTCTTC 2 cut(s) 3, 150
Eco130I CCWWGG 1 cut(s) 115
Eco57I CTGAAG 1 cut(s) 27
EcoT14I CCWWGG 1 cut(s) 115
EcoT22I ATGCAT 1 cut(s) 106
ErhI CCWWGG 1 cut(s) 115
FaeI CATG 1 cut(s) 151
FaiI YATR 3 cut(s) 149, 201, 203
FatI CATG 1 cut(s) 147
FokI GGATG 2 cut(s) 113, 132
GlaI GCGC 1 cut(s) 41
HaeIII GGCC 1 cut(s) 29
HhaI GCGC 1 cut(s) 42
Hin1II CATG 1 cut(s) 151
Hin6I GCGC 1 cut(s) 40
HinP1I GCGC 1 cut(s) 40
HphI GGTGA 1 cut(s) 120
Hpy188I TCNGA 1 cut(s) 88
Hpy188III TCNNGA 1 cut(s) 148
Hpy99I CGWCG 2 cut(s) 173, 179
HpyAV CCTTC 1 cut(s) 229
HpyCH4III ACNGT 2 cut(s) 35, 224
HpyCH4V TGCA 2 cut(s) 104, 212
HpyF10VI GCNNNNNNNGC 1 cut(s) 110
Hsp92II CATG 1 cut(s) 151
HspAI GCGC 1 cut(s) 40
Kzo9I GATC 1 cut(s) 13
LpnPI CCDG 1 cut(s) 144
LweI GCATC 2 cut(s) 91, 110
MalI GATC 1 cut(s) 15
MboI GATC 1 cut(s) 13
MboII GAAGA 3 cut(s) 20, 146, 167
MflI RGATCY 1 cut(s) 13
MluCI AATT 1 cut(s) 143
MnlI CCTC 2 cut(s) 4, 187
Mph1103I ATGCAT 1 cut(s) 106
MseI TTAA 1 cut(s) 256
MwoI GCNNNNNNNGC 1 cut(s) 110
NdeII GATC 1 cut(s) 13
NlaIII CATG 1 cut(s) 151
NlaIV GGNNCC 1 cut(s) 15
NsiI ATGCAT 1 cut(s) 106
PagI TCATGA 1 cut(s) 147
PspN4I GGNNCC 1 cut(s) 15
PsuI RGATCY 1 cut(s) 13
SaqAI TTAA 1 cut(s) 256
Sau3AI GATC 1 cut(s) 13
SetI ASST 1 cut(s) 96
SfaNI GCATC 2 cut(s) 91, 110
SgeI CNNG 9 cut(s) 47, 61, 107, 128, 143, 160, 205, 227, 236
Sse9I AATT 1 cut(s) 143
StyI CCWWGG 1 cut(s) 115
TaaI ACNGT 2 cut(s) 35, 224
TaqI TCGA 1 cut(s) 57
TasI AATT 1 cut(s) 143
Tru1I TTAA 1 cut(s) 256
Tru9I TTAA 1 cut(s) 256
TspDTI ATGAA 3 cut(s) 136, 172, 248
XapI RAATTY 1 cut(s) 143
Zsp2I ATGCAT 1 cut(s) 106
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.