Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000828.1

Orthogroup ID

OG0006584

Physical Location & Seq

Genomic Coordinates Forward (+)

91142 .. 91399

Gene Structure 258 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000828.1_g000021.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 258 bp

atggctgaagaggatcccaaagaaaaggccgaccgtgagcgcattttcaagcactttgacaccaatggcgatggcaaaatctcatcagatgagctaggggatgcattgaaagcccttggatgcgtttcaccagaagaaattaaattcatgatggaagagattgacaccgacggcgacggcttcatttcttacgaggagtatatatcttttgcagttgctaaccgtggtctaatgaaggatattgccaagatattttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04626 map04626

Pfam Domains

Protein Families

EF-hand_1

Protein Analysis

85

Amino Acids

9.57

Weight (kDa)

4.4

Isoelectric Point (pI)

24.35

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006584)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G03430 AT5G17480
fragaria_vesca	FvH4_1g28900 FvH4_3g11850
malus_domestica	MD05G1258400.v1.1 MD09G1262700.v1.1 MD17G1257600.v1.1
prunus_persica	Prupe.3G160400_v2.0.a1
pyrus_communis	pycom17g25970
rosa_chinensis	RchiOBHm_Chr3g0493401 RchiOBHm_Chr5g0019281
rosa_laevigata	RLG00000032434
rosa_multiflora	Rmu_sc0000828.1_g000021 Rmu_sc0004608.1_g000003 Rmu_sc0010338.1_g000013
rosa_roxburghii	Rroxscaffold_1G00058720 Rroxscaffold_6G00391610
rosa_rugosa	Rorug03G0260800 Rorug05G0049300
rosa_samantha	Rh3CG343600 Rh5AG140300 Rh5BG139400 Rh5CG150700 Rh5DG139900
rosa_wichuraiana	Rw3G027220 Rw5G012480

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	8, 21
AcsI	RAATTY	1 cut(s)	143
AcuI	CTGAAG	1 cut(s)	27
AgsI	TTSAA	2 cut(s)	49, 109
AluBI	AGCT	1 cut(s)	94
AluI	AGCT	1 cut(s)	94
AlwI	GGATC	2 cut(s)	8, 21
AoxI	GGCC	1 cut(s)	27
ApoI	RAATTY	1 cut(s)	143
AspLEI	GCGC	1 cut(s)	42
AsuHPI	GGTGA	1 cut(s)	120
BamHI	GGATCC	1 cut(s)	13
BccI	CCATC	2 cut(s)	65, 145
BceAI	ACGGC	2 cut(s)	187, 193
BfaI	CTAG	1 cut(s)	95
BmiI	GGNNCC	1 cut(s)	15
BmsI	GCATC	2 cut(s)	91, 110
BsaJI	CCNNGG	2 cut(s)	115, 223
BseDI	CCNNGG	2 cut(s)	115, 223
BseGI	GGATG	2 cut(s)	106, 125
BseRI	GAGGAG	1 cut(s)	209
Bsh1285I	CGRYCG	1 cut(s)	34
BshFI	GGCC	1 cut(s)	29
BsiEI	CGRYCG	1 cut(s)	34
BsnI	GGCC	1 cut(s)	29
Bsp143I	GATC	1 cut(s)	13
BspANI	GGCC	1 cut(s)	29
BspHI	TCATGA	1 cut(s)	147
BspLI	GGNNCC	1 cut(s)	15
BspPI	GGATC	2 cut(s)	8, 21
BssECI	CCNNGG	2 cut(s)	115, 223
BssMI	GATC	1 cut(s)	13
BssT1I	CCWWGG	1 cut(s)	115
Bst4CI	ACNGT	2 cut(s)	35, 224
Bst6I	CTCTTC	2 cut(s)	3, 150
BstDSI	CCRYGG	1 cut(s)	223
BstF5I	GGATG	2 cut(s)	106, 125
BstHHI	GCGC	1 cut(s)	42
BstKTI	GATC	1 cut(s)	16
BstMBI	GATC	1 cut(s)	13
BstMCI	CGRYCG	1 cut(s)	34
BstMWI	GCNNNNNNNGC	1 cut(s)	110
BstX2I	RGATCY	1 cut(s)	13
BstYI	RGATCY	1 cut(s)	13
BsuRI	GGCC	1 cut(s)	29
BtgI	CCRYGG	1 cut(s)	223
BtgZI	GCGATG	1 cut(s)	84
BtsCI	GGATG	2 cut(s)	106, 125
CciI	TCATGA	1 cut(s)	147
CfoI	GCGC	1 cut(s)	42
CviAII	CATG	1 cut(s)	148
CviJI	RGCY	5 cut(s)	5, 29, 94, 113, 180
CviKI_1	RGCY	5 cut(s)	5, 29, 94, 113, 180
DpnI	GATC	1 cut(s)	15
DpnII	GATC	1 cut(s)	13
Eam1104I	CTCTTC	2 cut(s)	3, 150
EarI	CTCTTC	2 cut(s)	3, 150
Eco130I	CCWWGG	1 cut(s)	115
Eco57I	CTGAAG	1 cut(s)	27
EcoT14I	CCWWGG	1 cut(s)	115
EcoT22I	ATGCAT	1 cut(s)	106
ErhI	CCWWGG	1 cut(s)	115
FaeI	CATG	1 cut(s)	151
FaiI	YATR	3 cut(s)	149, 201, 203
FatI	CATG	1 cut(s)	147
FokI	GGATG	2 cut(s)	113, 132
FspBI	CTAG	1 cut(s)	95
GlaI	GCGC	1 cut(s)	41
HaeIII	GGCC	1 cut(s)	29
HhaI	GCGC	1 cut(s)	42
Hin1II	CATG	1 cut(s)	151
Hin6I	GCGC	1 cut(s)	40
HinP1I	GCGC	1 cut(s)	40
HphI	GGTGA	1 cut(s)	120
Hpy188I	TCNGA	1 cut(s)	88
Hpy188III	TCNNGA	1 cut(s)	148
Hpy99I	CGWCG	2 cut(s)	173, 179
HpyAV	CCTTC	1 cut(s)	229
HpyCH4III	ACNGT	2 cut(s)	35, 224
HpyCH4V	TGCA	2 cut(s)	104, 212
HpyF10VI	GCNNNNNNNGC	1 cut(s)	110
Hsp92II	CATG	1 cut(s)	151
HspAI	GCGC	1 cut(s)	40
Kzo9I	GATC	1 cut(s)	13
LpnPI	CCDG	1 cut(s)	144
LweI	GCATC	2 cut(s)	91, 110
MaeI	CTAG	1 cut(s)	95
MalI	GATC	1 cut(s)	15
MboI	GATC	1 cut(s)	13
MboII	GAAGA	3 cut(s)	20, 146, 167
MflI	RGATCY	1 cut(s)	13
MluCI	AATT	2 cut(s)	138, 143
MnlI	CCTC	2 cut(s)	4, 187
Mph1103I	ATGCAT	1 cut(s)	106
MseI	TTAA	2 cut(s)	141, 256
MwoI	GCNNNNNNNGC	1 cut(s)	110
NdeII	GATC	1 cut(s)	13
NlaIII	CATG	1 cut(s)	151
NlaIV	GGNNCC	1 cut(s)	15
NsiI	ATGCAT	1 cut(s)	106
PagI	TCATGA	1 cut(s)	147
PspN4I	GGNNCC	1 cut(s)	15
PsuI	RGATCY	1 cut(s)	13
SaqAI	TTAA	2 cut(s)	141, 256
Sau3AI	GATC	1 cut(s)	13
SetI	ASST	1 cut(s)	96
SfaNI	GCATC	2 cut(s)	91, 110
SgeI	CNNG	8 cut(s)	47, 61, 107, 128, 143, 160, 205, 236
Sse9I	AATT	2 cut(s)	138, 143
SspMI	CTAG	1 cut(s)	95
StyI	CCWWGG	1 cut(s)	115
TaaI	ACNGT	2 cut(s)	35, 224
TasI	AATT	2 cut(s)	138, 143
Tru1I	TTAA	2 cut(s)	141, 256
Tru9I	TTAA	2 cut(s)	141, 256
TspDTI	ATGAA	3 cut(s)	136, 172, 248
XapI	RAATTY	1 cut(s)	143
XspI	CTAG	1 cut(s)	95
Zsp2I	ATGCAT	1 cut(s)	106

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.