pycom17g25970

EF-hand domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0006584
Physical Location & Seq
Reverse (-)
24292039 .. 24292296
258 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g25970.1

Sequence Viewer

Length: 258 bp
ATGGCCGAAGAAGATCCTAAAGAAAAGGCTGATCGAGAGAGAATTTTCAAGCGGTTTGACACCAACGGCGATGGCCTAATTTCTGCAACCGAGCTAGGAGATGCATTAAAAACACTAGGCTGCGTTCAATCGGATGAAGTGAAATTTATGATGGCGGAGATTGATACCGACGGTGATGGCTTCATTTCGTACCAGGAGTACTTGAATTTTGCTCTAGCTAACCGTGGTTTAATTAAGGATATTGCCAAGATATTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
EF-hand_1

Protein Analysis

86

Amino Acids

9.54

Weight (kDa)

4.45

Isoelectric Point (pI)

18.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_1 PF00036 13 - 39 4.1e-07 EF hand domain
AIF-1 PF21008 13 - 80 7.8e-06 Allograft inflammatory factor 1
EF-hand_7 PF13499 14 - 71 2.1e-15 EF-hand domain pair
EF-hand_6 PF13405 14 - 40 6.7e-08 EF-hand domain
EF-hand_5 PF13202 15 - 33 5.1e-06 EF hand
EF-hand_1 PF00036 46 - 70 2.5e-07 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 52, 155
AclWI GGATC 1 cut(s) 8
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 3 cut(s) 42, 143, 205
AfaI GTAC 2 cut(s) 191, 200
AgsI TTSAA 3 cut(s) 49, 128, 205
AjnI CCWGG 1 cut(s) 192
AluBI AGCT 2 cut(s) 94, 218
AluI AGCT 2 cut(s) 94, 218
AlwI GGATC 1 cut(s) 8
AoxI GGCC 2 cut(s) 3, 73
ApeKI GCWGC 1 cut(s) 120
ApoI RAATTY 3 cut(s) 42, 143, 205
AsuHPI GGTGA 1 cut(s) 185
BbvI GCAGC 1 cut(s) 107
BccI CCATC 3 cut(s) 65, 145, 170
BceAI ACGGC 1 cut(s) 82
BciT130I CCWGG 1 cut(s) 194
BfaI CTAG 3 cut(s) 95, 116, 215
BisI GCNGC 1 cut(s) 121
BlsI GCNGC 1 cut(s) 122
BmcAI AGTACT 1 cut(s) 200
Bme1390I CCNGG 1 cut(s) 194
BmrFI CCNGG 1 cut(s) 194
BmsI GCATC 1 cut(s) 91
BsaJI CCNNGG 1 cut(s) 223
BseBI CCWGG 1 cut(s) 194
BseDI CCNNGG 1 cut(s) 223
BseGI GGATG 1 cut(s) 139
BseXI GCAGC 1 cut(s) 107
BshFI GGCC 2 cut(s) 5, 75
BsnI GGCC 2 cut(s) 5, 75
Bsp143I GATC 2 cut(s) 13, 31
BspACI CCGC 2 cut(s) 52, 155
BspANI GGCC 2 cut(s) 5, 75
BspPI GGATC 1 cut(s) 8
BssECI CCNNGG 1 cut(s) 223
BssMI GATC 2 cut(s) 13, 31
Bst2UI CCWGG 1 cut(s) 194
Bst4CI ACNGT 2 cut(s) 173, 224
BstDSI CCRYGG 1 cut(s) 223
BstF5I GGATG 1 cut(s) 139
BstKTI GATC 2 cut(s) 16, 34
BstMBI GATC 2 cut(s) 13, 31
BstNI CCWGG 1 cut(s) 194
BstSCI CCNGG 1 cut(s) 192
BstV1I GCAGC 1 cut(s) 107
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
BsuRI GGCC 2 cut(s) 5, 75
BtgI CCRYGG 1 cut(s) 223
BtgZI GCGATG 1 cut(s) 84
BtsCI GGATG 1 cut(s) 139
Csp6I GTAC 2 cut(s) 190, 199
CviJI RGCY 7 cut(s) 5, 29, 75, 94, 120, 180, 218
CviKI_1 RGCY 7 cut(s) 5, 29, 75, 94, 120, 180, 218
CviQI GTAC 2 cut(s) 190, 199
DpnI GATC 2 cut(s) 15, 33
DpnII GATC 2 cut(s) 13, 31
EaeI YGGCCR 1 cut(s) 3
EciI GGCGGA 1 cut(s) 170
EcoRII CCWGG 1 cut(s) 192
EcoT22I ATGCAT 1 cut(s) 106
FaiI YATR 1 cut(s) 149
Fnu4HI GCNGC 1 cut(s) 121
FokI GGATG 1 cut(s) 146
Fsp4HI GCNGC 1 cut(s) 121
FspBI CTAG 3 cut(s) 95, 116, 215
GluI GCNGC 1 cut(s) 121
HaeIII GGCC 2 cut(s) 5, 75
HphI GGTGA 1 cut(s) 185
Hpy188I TCNGA 1 cut(s) 133
Hpy188III TCNNGA 1 cut(s) 35
Hpy99I CGWCG 1 cut(s) 173
HpyCH4III ACNGT 2 cut(s) 173, 224
HpyCH4V TGCA 2 cut(s) 86, 104
Kzo9I GATC 2 cut(s) 13, 31
LpnPI CCDG 2 cut(s) 179, 206
Lsp1109I GCAGC 1 cut(s) 107
LweI GCATC 1 cut(s) 91
MaeI CTAG 3 cut(s) 95, 116, 215
MalI GATC 2 cut(s) 15, 33
MboI GATC 2 cut(s) 13, 31
MboII GAAGA 2 cut(s) 20, 23
MflI RGATCY 1 cut(s) 13
MluCI AATT 5 cut(s) 42, 78, 143, 205, 231
Mph1103I ATGCAT 1 cut(s) 106
MseI TTAA 3 cut(s) 107, 230, 234
MspR9I CCNGG 1 cut(s) 194
MvaI CCWGG 1 cut(s) 194
NdeII GATC 2 cut(s) 13, 31
NsiI ATGCAT 1 cut(s) 106
PacI TTAATTAA 1 cut(s) 234
PkrI GCNGC 1 cut(s) 122
Psp6I CCWGG 1 cut(s) 192
PspGI CCWGG 1 cut(s) 192
PsuI RGATCY 1 cut(s) 13
RsaI GTAC 2 cut(s) 191, 200
RsaNI GTAC 2 cut(s) 190, 199
SaqAI TTAA 3 cut(s) 107, 230, 234
SatI GCNGC 1 cut(s) 121
Sau3AI GATC 2 cut(s) 13, 31
ScaI AGTACT 1 cut(s) 200
ScrFI CCNGG 1 cut(s) 194
SetI ASST 2 cut(s) 96, 220
SfaNI GCATC 1 cut(s) 91
Sse9I AATT 5 cut(s) 42, 78, 143, 205, 231
SsiI CCGC 2 cut(s) 52, 155
SspMI CTAG 3 cut(s) 95, 116, 215
StyD4I CCNGG 1 cut(s) 192
TaaI ACNGT 2 cut(s) 173, 224
TaqI TCGA 1 cut(s) 34
TasI AATT 5 cut(s) 42, 78, 143, 205, 231
TatI WGTACW 1 cut(s) 198
Tru1I TTAA 3 cut(s) 107, 230, 234
Tru9I TTAA 3 cut(s) 107, 230, 234
TseI GCWGC 1 cut(s) 120
TspDTI ATGAA 2 cut(s) 150, 172
XapI RAATTY 3 cut(s) 42, 143, 205
XspI CTAG 3 cut(s) 95, 116, 215
ZrmI AGTACT 1 cut(s) 200
Zsp2I ATGCAT 1 cut(s) 106
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.