MD17G1257600.v1.1

EF-hand domain

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Reverse (-)
31817961 .. 31818218
258 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1257600.v1.1.491

Sequence Viewer

Length: 258 bp
ATGGCTGAAGAAGATCCTAAAGAAAAGGCTGATCGAGAGAGAATTTTCAAGCGGTTTGACACCAACGGCGATGGCCTAATTTCTGCAACCGAGCTAGGAGATGCATTAAAAACACTAGGCTGTGTTCAACCAGATGAAGTGAAGTTTATGATGGCGGAGATTGATACCGATGGTGATGGCTTCATTTCGTACAAGGAGTACTTGGATTTTGCTCTAGCTAACCGTGGTTTAATTAAGGATGTTGCCAAGATATTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.54

Weight (kDa)

4.47

Isoelectric Point (pI)

12.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_1 PF00036 13 - 39 4.1e-07 EF hand domain
EF-hand_7 PF13499 14 - 71 4.7e-15 EF-hand domain pair
EF-hand_6 PF13405 14 - 40 6.7e-08 EF-hand domain
EF-hand_5 PF13202 15 - 33 5.1e-06 EF hand
EF-hand_1 PF00036 46 - 70 5.6e-07 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 52, 155
AclWI GGATC 1 cut(s) 8
AcsI RAATTY 1 cut(s) 42
AcuI CTGAAG 1 cut(s) 27
AfaI GTAC 2 cut(s) 191, 200
AgsI TTSAA 2 cut(s) 49, 128
AluBI AGCT 2 cut(s) 94, 218
AluI AGCT 2 cut(s) 94, 218
AlwI GGATC 1 cut(s) 8
AoxI GGCC 1 cut(s) 73
ApoI RAATTY 1 cut(s) 42
AsuHPI GGTGA 1 cut(s) 185
BccI CCATC 4 cut(s) 65, 145, 164, 170
BceAI ACGGC 1 cut(s) 82
BfaI CTAG 3 cut(s) 95, 116, 215
BmcAI AGTACT 1 cut(s) 200
BmsI GCATC 1 cut(s) 91
BsaJI CCNNGG 1 cut(s) 223
BseDI CCNNGG 1 cut(s) 223
BseGI GGATG 1 cut(s) 244
BshFI GGCC 1 cut(s) 75
BsnI GGCC 1 cut(s) 75
Bsp143I GATC 2 cut(s) 13, 31
BspACI CCGC 2 cut(s) 52, 155
BspANI GGCC 1 cut(s) 75
BspPI GGATC 1 cut(s) 8
BssECI CCNNGG 1 cut(s) 223
BssMI GATC 2 cut(s) 13, 31
Bst4CI ACNGT 1 cut(s) 224
BstDSI CCRYGG 1 cut(s) 223
BstF5I GGATG 1 cut(s) 244
BstKTI GATC 2 cut(s) 16, 34
BstMBI GATC 2 cut(s) 13, 31
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
BsuRI GGCC 1 cut(s) 75
BtgI CCRYGG 1 cut(s) 223
BtgZI GCGATG 1 cut(s) 84
BtsCI GGATG 1 cut(s) 244
Csp6I GTAC 2 cut(s) 190, 199
CviJI RGCY 7 cut(s) 5, 29, 75, 94, 120, 180, 218
CviKI_1 RGCY 7 cut(s) 5, 29, 75, 94, 120, 180, 218
CviQI GTAC 2 cut(s) 190, 199
DpnI GATC 2 cut(s) 15, 33
DpnII GATC 2 cut(s) 13, 31
EciI GGCGGA 1 cut(s) 170
Eco57I CTGAAG 1 cut(s) 27
EcoT22I ATGCAT 1 cut(s) 106
FaiI YATR 1 cut(s) 149
FalI AAGNNNNNCTT 2 cut(s) 185, 217
FokI GGATG 1 cut(s) 251
FspBI CTAG 3 cut(s) 95, 116, 215
HaeIII GGCC 1 cut(s) 75
HphI GGTGA 1 cut(s) 185
Hpy188III TCNNGA 1 cut(s) 35
HpyCH4III ACNGT 1 cut(s) 224
HpyCH4V TGCA 2 cut(s) 86, 104
Kzo9I GATC 2 cut(s) 13, 31
LpnPI CCDG 1 cut(s) 144
LweI GCATC 1 cut(s) 91
MaeI CTAG 3 cut(s) 95, 116, 215
MalI GATC 2 cut(s) 15, 33
MboI GATC 2 cut(s) 13, 31
MboII GAAGA 2 cut(s) 20, 23
MflI RGATCY 1 cut(s) 13
MluCI AATT 3 cut(s) 42, 78, 231
Mph1103I ATGCAT 1 cut(s) 106
MseI TTAA 3 cut(s) 107, 230, 234
NdeII GATC 2 cut(s) 13, 31
NsiI ATGCAT 1 cut(s) 106
PacI TTAATTAA 1 cut(s) 234
PsuI RGATCY 1 cut(s) 13
RsaI GTAC 2 cut(s) 191, 200
RsaNI GTAC 2 cut(s) 190, 199
SaqAI TTAA 3 cut(s) 107, 230, 234
Sau3AI GATC 2 cut(s) 13, 31
ScaI AGTACT 1 cut(s) 200
SetI ASST 2 cut(s) 96, 220
SfaNI GCATC 1 cut(s) 91
Sse9I AATT 3 cut(s) 42, 78, 231
SsiI CCGC 2 cut(s) 52, 155
SspMI CTAG 3 cut(s) 95, 116, 215
TaaI ACNGT 1 cut(s) 224
TaqI TCGA 1 cut(s) 34
TasI AATT 3 cut(s) 42, 78, 231
TatI WGTACW 1 cut(s) 198
Tru1I TTAA 3 cut(s) 107, 230, 234
Tru9I TTAA 3 cut(s) 107, 230, 234
TspDTI ATGAA 2 cut(s) 150, 172
XapI RAATTY 1 cut(s) 42
XspI CTAG 3 cut(s) 95, 116, 215
ZrmI AGTACT 1 cut(s) 200
Zsp2I ATGCAT 1 cut(s) 106
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.