MD11G1114000.v1.1
MYB Family

transcription factor

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Forward (+)
10312847 .. 10313337
491 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1114000.v1.1.491

Sequence Viewer

Length: 153 bp
ATGAAAATGGTGCAAGATCAAGAACAGATCAGAAAGGGGCCATGGACTGAGCAAGAGGACTTCCAGTTGGTGTGCTTTGTGGGCCTGTTTGGAGACAGGCGATGGGATTTCATAGCCAAAGTTTCAGGTTTGAAGGTGGAGGGAGACAAATAA

Protein Analysis

51

Amino Acids

5.89

Weight (kDa)

5.17

Isoelectric Point (pI)

47.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 12 - 43 6e-08 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 133
Alw26I GTCTC 2 cut(s) 87, 138
AoxI GGCC 2 cut(s) 38, 82
AspS9I GGNCC 2 cut(s) 38, 82
BccI CCATC 1 cut(s) 96
BcoDI GTCTC 2 cut(s) 87, 138
BmgT120I GGNCC 2 cut(s) 38, 82
BmiI GGNNCC 1 cut(s) 39
BsaJI CCNNGG 1 cut(s) 41
Bse1I ACTGG 1 cut(s) 64
BseDI CCNNGG 1 cut(s) 41
BseMII CTCAG 1 cut(s) 39
BseNI ACTGG 1 cut(s) 64
BshFI GGCC 2 cut(s) 40, 84
BsmAI GTCTC 2 cut(s) 87, 138
BsnI GGCC 2 cut(s) 40, 84
Bsp143I GATC 2 cut(s) 16, 27
Bsp19I CCATGG 1 cut(s) 41
BspANI GGCC 2 cut(s) 40, 84
BspCNI CTCAG 1 cut(s) 40
BspLI GGNNCC 1 cut(s) 39
BsrI ACTGG 1 cut(s) 64
BssECI CCNNGG 1 cut(s) 41
BssMI GATC 2 cut(s) 16, 27
BssT1I CCWWGG 1 cut(s) 41
BstDEI CTNAG 1 cut(s) 48
BstDSI CCRYGG 1 cut(s) 41
BstKTI GATC 2 cut(s) 19, 30
BstMAI GTCTC 2 cut(s) 87, 138
BstMBI GATC 2 cut(s) 16, 27
BstMWI GCNNNNNNNGC 1 cut(s) 81
BsuRI GGCC 2 cut(s) 40, 84
BtgI CCRYGG 1 cut(s) 41
BtgZI GCGATG 1 cut(s) 115
Cfr13I GGNCC 2 cut(s) 38, 82
CviAII CATG 1 cut(s) 42
CviJI RGCY 3 cut(s) 40, 84, 116
CviKI_1 RGCY 3 cut(s) 40, 84, 116
DdeI CTNAG 1 cut(s) 48
DpnI GATC 2 cut(s) 18, 29
DpnII GATC 2 cut(s) 16, 27
Eco130I CCWWGG 1 cut(s) 41
EcoT14I CCWWGG 1 cut(s) 41
ErhI CCWWGG 1 cut(s) 41
FaeI CATG 1 cut(s) 45
FaiI YATR 2 cut(s) 43, 113
FatI CATG 1 cut(s) 41
HaeIII GGCC 2 cut(s) 40, 84
Hin1II CATG 1 cut(s) 45
Hpy188I TCNGA 1 cut(s) 32
Hpy188III TCNNGA 1 cut(s) 20
HpyAV CCTTC 1 cut(s) 127
HpyCH4V TGCA 1 cut(s) 13
HpyF10VI GCNNNNNNNGC 1 cut(s) 81
HpyF3I CTNAG 1 cut(s) 48
Hsp92II CATG 1 cut(s) 45
Kzo9I GATC 2 cut(s) 16, 27
LpnPI CCDG 4 cut(s) 77, 82, 98, 111
MalI GATC 2 cut(s) 18, 29
MboI GATC 2 cut(s) 16, 27
MnlI CCTC 2 cut(s) 49, 133
MwoI GCNNNNNNNGC 1 cut(s) 81
NcoI CCATGG 1 cut(s) 41
NdeII GATC 2 cut(s) 16, 27
NlaIII CATG 1 cut(s) 45
NlaIV GGNNCC 1 cut(s) 39
PspN4I GGNNCC 1 cut(s) 39
PspPI GGNCC 2 cut(s) 38, 82
Sau3AI GATC 2 cut(s) 16, 27
Sau96I GGNCC 2 cut(s) 38, 82
SetI ASST 2 cut(s) 130, 138
SgeI CNNG 8 cut(s) 26, 32, 54, 65, 76, 97, 109, 138
StyI CCWWGG 1 cut(s) 41
TspDTI ATGAA 2 cut(s) 17, 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.