MD11G1149300.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Reverse (-)
14139475 .. 14139725
251 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1149300.v1.1.491

Sequence Viewer

Length: 153 bp
ATGGCCCGGTCACGGAATGCAGTTGTTGCTACTGGTTTGGTGATGTTTGCAGCTGCAGGTTTGGCATTTCCGTTTTACATGGCGTCATCGCCAAAGCCTGTCATTGACCCATCAAAGCCGCTATCACCCCAGGCAACTTTTCGAGGGCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.22

Weight (kDa)

11.0

Isoelectric Point (pI)

81.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 47
AciI CCGC 1 cut(s) 119
AcyI GRCGYC 1 cut(s) 83
AfiI CCNNNNNNNGG 1 cut(s) 12
AjnI CCWGG 1 cut(s) 129
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
AoxI GGCC 2 cut(s) 3, 146
ApeKI GCWGC 2 cut(s) 50, 53
AspS9I GGNCC 2 cut(s) 4, 146
AsuC2I CCSGG 1 cut(s) 7
AsuHPI GGTGA 2 cut(s) 52, 117
BbvI GCAGC 2 cut(s) 40, 62
BccI CCATC 1 cut(s) 118
BciT130I CCWGG 1 cut(s) 131
BcnI CCSGG 1 cut(s) 7
BfmI CTRYAG 1 cut(s) 54
BfuAI ACCTGC 1 cut(s) 47
BisI GCNGC 3 cut(s) 51, 54, 119
BlsI GCNGC 3 cut(s) 52, 55, 120
Bme1390I CCNGG 2 cut(s) 7, 131
BmgT120I GGNCC 2 cut(s) 4, 146
BmrFI CCNGG 2 cut(s) 7, 131
BpuMI CCSGG 1 cut(s) 7
BsaHI GRCGYC 1 cut(s) 83
BsaJI CCNNGG 1 cut(s) 129
Bsc4I CCNNNNNNNGG 1 cut(s) 12
Bse1I ACTGG 1 cut(s) 37
BseBI CCWGG 1 cut(s) 131
BseDI CCNNGG 1 cut(s) 129
BseLI CCNNNNNNNGG 1 cut(s) 12
BseNI ACTGG 1 cut(s) 37
BseXI GCAGC 2 cut(s) 40, 62
BshFI GGCC 2 cut(s) 5, 148
BsiSI CCGG 1 cut(s) 7
BslI CCNNNNNNNGG 1 cut(s) 12
BsmI GAATGC 1 cut(s) 22
BsnI GGCC 2 cut(s) 5, 148
BspACI CCGC 1 cut(s) 119
BspANI GGCC 2 cut(s) 5, 148
BspMAI CTGCAG 1 cut(s) 58
BspMI ACCTGC 1 cut(s) 47
BsrI ACTGG 1 cut(s) 37
BssECI CCNNGG 1 cut(s) 129
BssNI GRCGYC 1 cut(s) 83
Bst2UI CCWGG 1 cut(s) 131
BstACI GRCGYC 1 cut(s) 83
BstAPI GCANNNNNTGC 1 cut(s) 26
BstDEI CTNAG 1 cut(s) 150
BstMWI GCNNNNNNNGC 2 cut(s) 26, 62
BstNI CCWGG 1 cut(s) 131
BstSCI CCNGG 2 cut(s) 5, 129
BstSFI CTRYAG 1 cut(s) 54
BstV1I GCAGC 2 cut(s) 40, 62
BsuRI GGCC 2 cut(s) 5, 148
BtgZI GCGATG 1 cut(s) 72
BveI ACCTGC 1 cut(s) 47
Cfr13I GGNCC 2 cut(s) 4, 146
CseI GACGC 1 cut(s) 72
CviAII CATG 1 cut(s) 79
CviJI RGCY 5 cut(s) 5, 53, 97, 118, 148
CviKI_1 RGCY 5 cut(s) 5, 53, 97, 118, 148
DdeI CTNAG 1 cut(s) 150
EcoO109I RGGNCCY 1 cut(s) 146
EcoRII CCWGG 1 cut(s) 129
FaeI CATG 1 cut(s) 82
FaiI YATR 1 cut(s) 80
FatI CATG 1 cut(s) 78
Fnu4HI GCNGC 3 cut(s) 51, 54, 119
Fsp4HI GCNGC 3 cut(s) 51, 54, 119
GluI GCNGC 3 cut(s) 51, 54, 119
HaeIII GGCC 2 cut(s) 5, 148
HapII CCGG 1 cut(s) 7
HgaI GACGC 1 cut(s) 72
Hin1I GRCGYC 1 cut(s) 83
Hin1II CATG 1 cut(s) 82
HpaII CCGG 1 cut(s) 7
HphI GGTGA 2 cut(s) 52, 117
HpyCH4V TGCA 3 cut(s) 20, 50, 56
HpyF10VI GCNNNNNNNGC 2 cut(s) 26, 62
HpyF3I CTNAG 1 cut(s) 150
Hsp92I GRCGYC 1 cut(s) 83
Hsp92II CATG 1 cut(s) 82
LpnPI CCDG 6 cut(s) 18, 20, 42, 111, 116, 143
Lsp1109I GCAGC 2 cut(s) 40, 62
MaeIII GTNAC 1 cut(s) 9
MnlI CCTC 1 cut(s) 137
MspA1I CMGCKG 1 cut(s) 53
MspI CCGG 1 cut(s) 7
MspR9I CCNGG 2 cut(s) 7, 131
Mva1269I GAATGC 1 cut(s) 22
MvaI CCWGG 1 cut(s) 131
MwoI GCNNNNNNNGC 2 cut(s) 26, 62
NciI CCSGG 1 cut(s) 7
NlaIII CATG 1 cut(s) 82
NmuCI GTSAC 1 cut(s) 9
PctI GAATGC 1 cut(s) 22
PkrI GCNGC 3 cut(s) 52, 55, 120
Psp6I CCWGG 1 cut(s) 129
PspGI CCWGG 1 cut(s) 129
PspPI GGNCC 2 cut(s) 4, 146
PstI CTGCAG 1 cut(s) 58
PvuII CAGCTG 1 cut(s) 53
SatI GCNGC 3 cut(s) 51, 54, 119
Sau96I GGNCC 2 cut(s) 4, 146
ScrFI CCNGG 2 cut(s) 7, 131
SetI ASST 2 cut(s) 55, 61
SfcI CTRYAG 1 cut(s) 54
SgeI CNNG 9 cut(s) 18, 19, 24, 45, 69, 91, 110, 142, 143
SsiI CCGC 1 cut(s) 119
StyD4I CCNGG 2 cut(s) 5, 129
TaqI TCGA 1 cut(s) 142
TauI GCSGC 1 cut(s) 121
TseFI GTSAC 1 cut(s) 9
TseI GCWGC 2 cut(s) 50, 53
Tsp45I GTSAC 1 cut(s) 9
TspGWI ACGGA 2 cut(s) 28, 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.