Rmu_sc0000366.1_g000045

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000366.1
Physical Location & Seq
Forward (+)
182546 .. 182837
292 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000366.1_g000045.1.cds

Sequence Viewer

Length: 210 bp
atggccctatcacggaatgccattgttgctactggcttggtagttttcgcatctgcggggctggcatttcccttttacatggcgtcatcaaaaacacctgttatcgatccaacaaagccactgtcacctcaggcaacttttcgagggccttacataaacactggttcgcgtgacgttggacctgatcatcagacctacccaaagaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.35

Weight (kDa)

9.87

Isoelectric Point (pI)

46.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 169
AciI CCGC 1 cut(s) 56
AclWI GGATC 1 cut(s) 101
AcyI GRCGYC 1 cut(s) 83
AfiI CCNNNNNNNGG 1 cut(s) 12
AlwI GGATC 1 cut(s) 101
AoxI GGCC 2 cut(s) 3, 146
ArsI GACNNNNNNTTYG 2 cut(s) 107, 139
AspS9I GGNCC 3 cut(s) 4, 146, 179
AsuHPI GGTGA 1 cut(s) 117
AvaII GGWCC 1 cut(s) 179
AxyI CCTNAGG 1 cut(s) 129
BclI TGATCA 1 cut(s) 184
Bme18I GGWCC 1 cut(s) 179
BmgT120I GGNCC 3 cut(s) 4, 146, 179
BmsI GCATC 1 cut(s) 59
Bsa29I ATCGAT 1 cut(s) 105
BsaHI GRCGYC 1 cut(s) 83
Bsc4I CCNNNNNNNGG 1 cut(s) 12
Bse1I ACTGG 2 cut(s) 37, 166
Bse21I CCTNAGG 1 cut(s) 129
BseCI ATCGAT 1 cut(s) 105
BseLI CCNNNNNNNGG 1 cut(s) 12
BseMII CTCAG 1 cut(s) 143
BseNI ACTGG 2 cut(s) 37, 166
Bsh1236I CGCG 1 cut(s) 169
BshFI GGCC 2 cut(s) 5, 148
BshVI ATCGAT 1 cut(s) 105
BslI CCNNNNNNNGG 1 cut(s) 12
BsmI GAATGC 1 cut(s) 22
BsnI GGCC 2 cut(s) 5, 148
Bsp143I GATC 2 cut(s) 106, 184
BspACI CCGC 1 cut(s) 56
BspANI GGCC 2 cut(s) 5, 148
BspCNI CTCAG 1 cut(s) 142
BspDI ATCGAT 1 cut(s) 105
BspFNI CGCG 1 cut(s) 169
BspPI GGATC 1 cut(s) 101
BsrI ACTGG 2 cut(s) 37, 166
BssMI GATC 2 cut(s) 106, 184
BssNI GRCGYC 1 cut(s) 83
Bst4CI ACNGT 1 cut(s) 123
BstACI GRCGYC 1 cut(s) 83
BstC8I GCNNGC 1 cut(s) 63
BstDEI CTNAG 1 cut(s) 129
BstFNI CGCG 1 cut(s) 169
BstKTI GATC 2 cut(s) 109, 187
BstMBI GATC 2 cut(s) 106, 184
BstMWI GCNNNNNNNGC 2 cut(s) 26, 62
BstUI CGCG 1 cut(s) 169
Bsu15I ATCGAT 1 cut(s) 105
Bsu36I CCTNAGG 1 cut(s) 129
BsuRI GGCC 2 cut(s) 5, 148
BsuTUI ATCGAT 1 cut(s) 105
BtsIMutI CAGTG 2 cut(s) 119, 159
Cac8I GCNNGC 1 cut(s) 63
Cfr13I GGNCC 3 cut(s) 4, 146, 179
ClaI ATCGAT 1 cut(s) 105
CseI GACGC 1 cut(s) 72
CviAII CATG 1 cut(s) 79
CviJI RGCY 5 cut(s) 5, 36, 61, 118, 148
CviKI_1 RGCY 5 cut(s) 5, 36, 61, 118, 148
DdeI CTNAG 1 cut(s) 129
DpnI GATC 2 cut(s) 108, 186
DpnII GATC 2 cut(s) 106, 184
Eco47I GGWCC 1 cut(s) 179
Eco81I CCTNAGG 1 cut(s) 129
EcoO109I RGGNCCY 1 cut(s) 146
FaeI CATG 1 cut(s) 82
FaiI YATR 2 cut(s) 80, 155
FatI CATG 1 cut(s) 78
FauI CCCGC 1 cut(s) 49
FbaI TGATCA 1 cut(s) 184
HaeIII GGCC 2 cut(s) 5, 148
HgaI GACGC 1 cut(s) 72
Hin1I GRCGYC 1 cut(s) 83
Hin1II CATG 1 cut(s) 82
HphI GGTGA 1 cut(s) 117
Hpy188I TCNGA 1 cut(s) 192
HpyCH4III ACNGT 1 cut(s) 123
HpyCH4IV ACGT 1 cut(s) 174
HpyF10VI GCNNNNNNNGC 2 cut(s) 26, 62
HpyF3I CTNAG 1 cut(s) 129
HpySE526I ACGT 1 cut(s) 174
Hsp92I GRCGYC 1 cut(s) 83
Hsp92II CATG 1 cut(s) 82
Ksp22I TGATCA 1 cut(s) 184
Kzo9I GATC 2 cut(s) 106, 184
LpnPI CCDG 6 cut(s) 18, 47, 111, 116, 147, 195
LweI GCATC 1 cut(s) 59
MaeII ACGT 1 cut(s) 174
MaeIII GTNAC 2 cut(s) 123, 170
MalI GATC 2 cut(s) 108, 186
MboI GATC 2 cut(s) 106, 184
MmeI TCCRAC 2 cut(s) 134, 157
MnlI CCTC 2 cut(s) 137, 138
Mva1269I GAATGC 1 cut(s) 22
MvnI CGCG 1 cut(s) 169
MwoI GCNNNNNNNGC 2 cut(s) 26, 62
NdeII GATC 2 cut(s) 106, 184
NlaIII CATG 1 cut(s) 82
NmuCI GTSAC 2 cut(s) 123, 170
PctI GAATGC 1 cut(s) 22
PspPI GGNCC 3 cut(s) 4, 146, 179
Sau3AI GATC 2 cut(s) 106, 184
Sau96I GGNCC 3 cut(s) 4, 146, 179
SetI ASST 5 cut(s) 100, 130, 177, 184, 197
SfaNI GCATC 1 cut(s) 59
SinI GGWCC 1 cut(s) 179
SsiI CCGC 1 cut(s) 56
TaaI ACNGT 1 cut(s) 123
TaiI ACGT 1 cut(s) 177
TaqI TCGA 2 cut(s) 105, 142
TscAI CASTG 2 cut(s) 126, 166
TseFI GTSAC 2 cut(s) 123, 170
Tsp45I GTSAC 2 cut(s) 123, 170
TspGWI ACGGA 1 cut(s) 28
TspRI CASTG 2 cut(s) 126, 166
VpaK11BI GGWCC 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.