MD12G1017000.v1.1

histone deacetylase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
OG0010700
Physical Location & Seq
Reverse (-)
1659578 .. 1660189
612 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1017000.v1.1.491

Sequence Viewer

Length: 315 bp
ATGTCTTGTATTCATTCTGAAACTTGTGCTGAGGTAAAAAGTGGTCAGTCTCTTGTTGTTGAACCTGGTAAAAAGCTCCTGCACCTTTCACAGGGTTGTCTTGATGACCTTAAGAAAGCGAAGGGAAGCGATCCTATTTCACTCTTTGCGAAAATTGGCGATCAGAAGCTTACCCTTGGATTTCTTTCTGCTGATAAATACCCGCAGTTAATGTTTGATATTGTGTTTGATCAGAAATTTGAGCTATCTCATAACTGGAAAAATGGGAGCGTCCACTTCACTGGATACAAGTCTTTGGGATATCCTTTTTGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-met

Protein Analysis

105

Amino Acids

11.54

Weight (kDa)

7.68

Isoelectric Point (pI)

27.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NPL PF17800 10 - 96 7.9e-12 Nucleoplasmin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010700)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G03740
fragaria_vesca FvH4_6g17790
malus_domestica MD12G1017000.v1.1 MD14G1014900.v1.1
prunus_persica Prupe.7G118500_v2.0.a1 Prupe.7G118500_v2.0.a1
pyrus_communis pycom12g01380 pycom14g01240
rosa_chinensis RchiOBHm_Chr3g0472041
rosa_laevigata RLG00000024110
rosa_multiflora Rmu_sc0002532.1_g000010
rosa_roxburghii Rroxscaffold_6G00409300
rosa_rugosa Rorug03G0121800
rosa_samantha Rh3AG173400 Rh3AG173500 Rh3BG198900 Rh3CG190000 Rh3CG197400 Rh3DG175600
rosa_wichuraiana Rw3G016710

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 203
AclWI GGATC 1 cut(s) 125
AcsI RAATTY 1 cut(s) 236
AfiI CCNNNNNNNGG 1 cut(s) 91
AflII CTTAAG 1 cut(s) 110
AgsI TTSAA 1 cut(s) 62
AjnI CCWGG 1 cut(s) 64
AluBI AGCT 3 cut(s) 76, 169, 244
AluI AGCT 3 cut(s) 76, 169, 244
Alw26I GTCTC 1 cut(s) 54
AlwI GGATC 1 cut(s) 125
ApoI RAATTY 1 cut(s) 236
BbvCI CCTCAGC 1 cut(s) 30
BciT130I CCWGG 1 cut(s) 66
BciVI GTATCC 1 cut(s) 278
BclI TGATCA 1 cut(s) 229
BcoDI GTCTC 1 cut(s) 54
BfrI CTTAAG 1 cut(s) 110
BfuI GTATCC 1 cut(s) 278
Bme1390I CCNGG 1 cut(s) 66
BmrFI CCNGG 1 cut(s) 66
Bpu10I CCTNAGC 1 cut(s) 30
BsaJI CCNNGG 1 cut(s) 175
Bsc4I CCNNNNNNNGG 1 cut(s) 91
Bse1I ACTGG 2 cut(s) 260, 286
BseBI CCWGG 1 cut(s) 66
BseDI CCNNGG 1 cut(s) 175
BseLI CCNNNNNNNGG 1 cut(s) 91
BseMII CTCAG 1 cut(s) 21
BseNI ACTGG 2 cut(s) 260, 286
BsgI GTGCAG 1 cut(s) 65
BslI CCNNNNNNNGG 1 cut(s) 91
BsmAI GTCTC 1 cut(s) 54
Bsp143I GATC 3 cut(s) 130, 160, 229
BspACI CCGC 1 cut(s) 203
BspCNI CTCAG 1 cut(s) 22
BspPI GGATC 1 cut(s) 125
BspTI CTTAAG 1 cut(s) 110
BsrI ACTGG 2 cut(s) 260, 286
BssECI CCNNGG 1 cut(s) 175
BssMI GATC 3 cut(s) 130, 160, 229
BssT1I CCWWGG 1 cut(s) 175
Bst2UI CCWGG 1 cut(s) 66
BstAFI CTTAAG 1 cut(s) 110
BstDEI CTNAG 1 cut(s) 30
BstENI CCTNNNNNAGG 1 cut(s) 89
BstKTI GATC 3 cut(s) 133, 163, 232
BstMAI GTCTC 1 cut(s) 54
BstMBI GATC 3 cut(s) 130, 160, 229
BstNI CCWGG 1 cut(s) 66
BstSCI CCNGG 1 cut(s) 64
BstXI CCANNNNNNTGG 1 cut(s) 281
BsuI GTATCC 1 cut(s) 278
BtsIMutI CAGTG 1 cut(s) 279
CseI GACGC 1 cut(s) 259
CsiI ACCWGGT 1 cut(s) 64
CviJI RGCY 3 cut(s) 76, 169, 244
CviKI_1 RGCY 3 cut(s) 76, 169, 244
DdeI CTNAG 1 cut(s) 30
DpnI GATC 3 cut(s) 132, 162, 231
DpnII GATC 3 cut(s) 130, 160, 229
Eco130I CCWWGG 1 cut(s) 175
Eco32I GATATC 1 cut(s) 302
EcoNI CCTNNNNNAGG 1 cut(s) 89
EcoRII CCWGG 1 cut(s) 64
EcoRV GATATC 1 cut(s) 302
EcoT14I CCWWGG 1 cut(s) 175
ErhI CCWWGG 1 cut(s) 175
FaiI YATR 1 cut(s) 252
FauI CCCGC 1 cut(s) 210
FbaI TGATCA 1 cut(s) 229
HgaI GACGC 1 cut(s) 259
HindIII AAGCTT 1 cut(s) 167
Hpy166II GTNNAC 1 cut(s) 274
Hpy188I TCNGA 3 cut(s) 19, 165, 234
Hpy188III TCNNGA 1 cut(s) 101
Hpy8I GTNNAC 1 cut(s) 274
HpyAV CCTTC 1 cut(s) 115
HpyCH4V TGCA 1 cut(s) 82
HpyF3I CTNAG 1 cut(s) 30
Ksp22I TGATCA 1 cut(s) 229
Kzo9I GATC 3 cut(s) 130, 160, 229
LmnI GCTCC 2 cut(s) 81, 267
LpnPI CCDG 6 cut(s) 51, 77, 78, 92, 241, 267
MabI ACCWGGT 1 cut(s) 64
MalI GATC 3 cut(s) 132, 162, 231
MboI GATC 3 cut(s) 130, 160, 229
MluCI AATT 2 cut(s) 153, 236
MnlI CCTC 1 cut(s) 25
MseI TTAA 3 cut(s) 111, 209, 313
MspCI CTTAAG 1 cut(s) 110
MspR9I CCNGG 1 cut(s) 66
MvaI CCWGG 1 cut(s) 66
NdeII GATC 3 cut(s) 130, 160, 229
Psp6I CCWGG 1 cut(s) 64
PspGI CCWGG 1 cut(s) 64
SaqAI TTAA 3 cut(s) 111, 209, 313
Sau3AI GATC 3 cut(s) 130, 160, 229
ScrFI CCNGG 1 cut(s) 66
SetI ASST 7 cut(s) 36, 67, 78, 87, 111, 171, 246
SexAI ACCWGGT 1 cut(s) 64
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
Sse9I AATT 2 cut(s) 153, 236
SsiI CCGC 1 cut(s) 203
StyD4I CCNGG 1 cut(s) 64
StyI CCWWGG 1 cut(s) 175
TasI AATT 2 cut(s) 153, 236
Tru1I TTAA 3 cut(s) 111, 209, 313
Tru9I TTAA 3 cut(s) 111, 209, 313
TscAI CASTG 1 cut(s) 286
TspRI CASTG 1 cut(s) 286
Vha464I CTTAAG 1 cut(s) 110
XagI CCTNNNNNAGG 1 cut(s) 89
XapI RAATTY 1 cut(s) 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.