MD12G1074300.v1.1

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
Physical Location & Seq
Reverse (-)
8940566 .. 8944122
3557 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1074300.v1.1.491

Sequence Viewer

Length: 249 bp
ATGCTTGGAAAACTACGGATGTCTATTTTCTGGAGCATTTCACAGATTGCTAATATCATTTTTCTAGAAGAAGTTATGGTTGTTTTAACACTGAAAGGTTCCCAAGAGGCTGAGCAGTTTGTAACTGACAAGAATGCATTGAAAGCAATAAATCCAATAAATCTATCAGCCAAAACTAATGTAGCCAAGAACAAGTCAGCTGACACCTATTCAAATATCAGAGGAAATGGAATTAAAGATGAGGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

83

Amino Acids

9.09

Weight (kDa)

8.01

Isoelectric Point (pI)

27.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 142, 213
AluBI AGCT 1 cut(s) 200
AluI AGCT 1 cut(s) 200
BfaI CTAG 1 cut(s) 65
BlpI GCTNAGC 1 cut(s) 111
BmiI GGNNCC 1 cut(s) 100
BpmI CTGGAG 1 cut(s) 52
Bpu1102I GCTNAGC 1 cut(s) 111
BseGI GGATG 1 cut(s) 24
BseMII CTCAG 1 cut(s) 102
BsmI GAATGC 1 cut(s) 139
Bsp1720I GCTNAGC 1 cut(s) 111
BspCNI CTCAG 1 cut(s) 103
BspLI GGNNCC 1 cut(s) 100
BstDEI CTNAG 1 cut(s) 111
BstF5I GGATG 1 cut(s) 24
BstMWI GCNNNNNNNGC 1 cut(s) 143
BtsCI GGATG 1 cut(s) 24
BtsIMutI CAGTG 1 cut(s) 89
CviJI RGCY 4 cut(s) 110, 170, 185, 200
CviKI_1 RGCY 4 cut(s) 110, 170, 185, 200
DdeI CTNAG 1 cut(s) 111
EcoT22I ATGCAT 1 cut(s) 139
FaiI YATR 1 cut(s) 77
FokI GGATG 1 cut(s) 31
FspBI CTAG 1 cut(s) 65
GsuI CTGGAG 1 cut(s) 52
Hpy188I TCNGA 1 cut(s) 221
Hpy188III TCNNGA 2 cut(s) 31, 65
HpyCH4V TGCA 1 cut(s) 137
HpyF10VI GCNNNNNNNGC 1 cut(s) 143
HpyF3I CTNAG 1 cut(s) 111
LmnI GCTCC 1 cut(s) 33
LpnPI CCDG 1 cut(s) 16
MaeI CTAG 1 cut(s) 65
MaeIII GTNAC 1 cut(s) 121
MboII GAAGA 1 cut(s) 80
MluCI AATT 1 cut(s) 231
MnlI CCTC 3 cut(s) 100, 215, 235
Mph1103I ATGCAT 1 cut(s) 139
MseI TTAA 3 cut(s) 86, 234, 247
MspA1I CMGCKG 1 cut(s) 200
Mva1269I GAATGC 1 cut(s) 139
MwoI GCNNNNNNNGC 1 cut(s) 143
NlaIV GGNNCC 1 cut(s) 100
NsiI ATGCAT 1 cut(s) 139
PctI GAATGC 1 cut(s) 139
PspN4I GGNNCC 1 cut(s) 100
PvuII CAGCTG 1 cut(s) 200
SaqAI TTAA 3 cut(s) 86, 234, 247
SetI ASST 3 cut(s) 100, 202, 209
SgeI CNNG 7 cut(s) 17, 43, 77, 116, 142, 199, 205
Sse9I AATT 1 cut(s) 231
SspMI CTAG 1 cut(s) 65
TasI AATT 1 cut(s) 231
Tru1I TTAA 3 cut(s) 86, 234, 247
Tru9I TTAA 3 cut(s) 86, 234, 247
TscAI CASTG 1 cut(s) 96
TspGWI ACGGA 1 cut(s) 31
TspRI CASTG 1 cut(s) 96
XbaI TCTAGA 1 cut(s) 64
XspI CTAG 1 cut(s) 65
Zsp2I ATGCAT 1 cut(s) 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.