pycom13g07670

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
5070091 .. 5070321
231 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g07670.1

Sequence Viewer

Length: 231 bp
ATGTCTATTTTCTGGAAAATTTCGCGGATTGTTAATATCATTTTTCTAGAAGAAGTTATGGCCATTTTAACACTGAAAGGTTCCCAACAAGCTGAGCAGTTTGTAACTGACAAGAAAGCATTGAAAGCAATAAATCCAATAAATTTAGCAGCCAAAACTGATGCAATCAAGAACAAACCAGCTGACACCTATTCAAATAATAGAGGAAATGAAATTAAAGATGAGGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

77

Amino Acids

8.57

Weight (kDa)

7.99

Isoelectric Point (pI)

32.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 25
AciI CCGC 1 cut(s) 25
AcoI YGGCCR 1 cut(s) 60
AcsI RAATTY 2 cut(s) 18, 142
AgsI TTSAA 2 cut(s) 124, 195
AluBI AGCT 2 cut(s) 92, 182
AluI AGCT 2 cut(s) 92, 182
AoxI GGCC 1 cut(s) 60
ApeKI GCWGC 1 cut(s) 149
ApoI RAATTY 2 cut(s) 18, 142
BalI TGGCCA 1 cut(s) 62
BbvI GCAGC 1 cut(s) 161
BfaI CTAG 1 cut(s) 47
BisI GCNGC 1 cut(s) 150
BlpI GCTNAGC 1 cut(s) 93
BlsI GCNGC 1 cut(s) 151
BmiI GGNNCC 1 cut(s) 82
BmsI GCATC 1 cut(s) 151
Bpu1102I GCTNAGC 1 cut(s) 93
BseMII CTCAG 1 cut(s) 84
BseXI GCAGC 1 cut(s) 161
Bsh1236I CGCG 1 cut(s) 25
BshFI GGCC 1 cut(s) 62
BsnI GGCC 1 cut(s) 62
Bsp1720I GCTNAGC 1 cut(s) 93
BspACI CCGC 1 cut(s) 25
BspANI GGCC 1 cut(s) 62
BspCNI CTCAG 1 cut(s) 85
BspFNI CGCG 1 cut(s) 25
BspLI GGNNCC 1 cut(s) 82
BstDEI CTNAG 1 cut(s) 93
BstFNI CGCG 1 cut(s) 25
BstMWI GCNNNNNNNGC 1 cut(s) 125
BstUI CGCG 1 cut(s) 25
BstV1I GCAGC 1 cut(s) 161
BsuRI GGCC 1 cut(s) 62
BtsIMutI CAGTG 1 cut(s) 71
CviJI RGCY 4 cut(s) 62, 92, 152, 182
CviKI_1 RGCY 4 cut(s) 62, 92, 152, 182
DdeI CTNAG 1 cut(s) 93
EaeI YGGCCR 1 cut(s) 60
FaiI YATR 1 cut(s) 59
Fnu4HI GCNGC 1 cut(s) 150
Fsp4HI GCNGC 1 cut(s) 150
FspBI CTAG 1 cut(s) 47
GluI GCNGC 1 cut(s) 150
HaeIII GGCC 1 cut(s) 62
Hpy188III TCNNGA 3 cut(s) 13, 47, 169
HpyCH4V TGCA 1 cut(s) 164
HpyF10VI GCNNNNNNNGC 1 cut(s) 125
HpyF3I CTNAG 1 cut(s) 93
LpnPI CCDG 1 cut(s) 192
Lsp1109I GCAGC 1 cut(s) 161
LweI GCATC 1 cut(s) 151
MaeI CTAG 1 cut(s) 47
MaeIII GTNAC 1 cut(s) 103
MboII GAAGA 1 cut(s) 62
MlsI TGGCCA 1 cut(s) 62
MluCI AATT 3 cut(s) 18, 142, 213
MluNI TGGCCA 1 cut(s) 62
MnlI CCTC 2 cut(s) 197, 217
Mox20I TGGCCA 1 cut(s) 62
MscI TGGCCA 1 cut(s) 62
MseI TTAA 4 cut(s) 33, 68, 216, 229
Msp20I TGGCCA 1 cut(s) 62
MspA1I CMGCKG 1 cut(s) 182
MvnI CGCG 1 cut(s) 25
MwoI GCNNNNNNNGC 1 cut(s) 125
NlaIV GGNNCC 1 cut(s) 82
PkrI GCNGC 1 cut(s) 151
PspN4I GGNNCC 1 cut(s) 82
PvuII CAGCTG 1 cut(s) 182
SaqAI TTAA 4 cut(s) 33, 68, 216, 229
SatI GCNGC 1 cut(s) 150
SetI ASST 4 cut(s) 82, 94, 184, 191
SfaNI GCATC 1 cut(s) 151
SgeI CNNG 7 cut(s) 25, 36, 59, 101, 124, 181, 191
Sse9I AATT 3 cut(s) 18, 142, 213
SsiI CCGC 1 cut(s) 25
SspMI CTAG 1 cut(s) 47
TasI AATT 3 cut(s) 18, 142, 213
Tru1I TTAA 4 cut(s) 33, 68, 216, 229
Tru9I TTAA 4 cut(s) 33, 68, 216, 229
TscAI CASTG 1 cut(s) 78
TseI GCWGC 1 cut(s) 149
TspDTI ATGAA 1 cut(s) 225
TspRI CASTG 1 cut(s) 78
XapI RAATTY 2 cut(s) 18, 142
XbaI TCTAGA 1 cut(s) 46
XspI CTAG 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.